Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
2014-January Volume 9 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
2014-January Volume 9 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Comparative analysis of various donor cell types for somatic cell nuclear transfer and its association with apoptosis and senescence

  • Authors:
    • Eunhye Kim
    • Sang‑Hwan Hyun
  • View Affiliations / Copyright

    Affiliations: Laboratory of Veterinary Embryology and Biotechnology, College of Veterinary Medicine, Chungbuk National University, Cheongju, Chungbuk 361‑763, Republic of Korea
  • Pages: 63-68
    |
    Published online on: November 5, 2013
       https://doi.org/10.3892/mmr.2013.1776
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The aim of the present study was to characterize potential somatic cell nuclear transfer (SCNT) donor cells by comparing two lines of transfected cells with their non‑modified parental controls in culture. Fetal fibroblasts used in the study originated from crossbred Landrace x Yorkshire x Duroc (LYD) or Yucatan mini‑pigs. The LYD fibroblasts were modified by the transfection of a tetracycline on/off gene, whereas Yucatan fibroblasts were triple transfected with the complement regulatory factors, human decay‑accelerating factor and human CD59, as well as H‑transferase. At the 9th doubling passage, parameters associated with senescence and apoptosis, including morphology, mRNA expression (TP53, Bcl‑2, Bax) and reactive oxygen species (ROS) levels, were evaluated. Population doubling (PD) time was calculated by assessing the time required for cell numbers to double by averaging the three cell passages. Quantitative polymerase chain reaction revealed that when comparing LYD with Yucatan fibroblasts, the latter exhibited a lower relative expression of TP53 and a higher relative expression of antiproliferative Bcl‑2, which correlated with the PD time results (26 and 40 h, respectively). Tetracycline on/off transfected cell lines exhibited a lower relative expression of antiapoptotic Bcl‑2 compared with their originating LYD cells. Similarly, triple transgenic cells exhibited higher TP53 and Bax mRNA expression levels than their non‑transgenic counterparts. For ROS measurement, cells were incubated with 2',7'‑dichlorofluorescin diacetate under the same conditions and were analyzed by flow cytometry. Yucatan fibroblasts exhibited higher ROS content than LYD cells. In addition, the two transgenic cell lines produced higher ROS levels than their corresponding non‑transfected cell lines. In conclusion, these results indicate that characteristics associated with senescence and apoptosis in transfected cells during culture may affect the efficiency of SCNT when used as donor cells for the production of transgenic swine.

Introduction

Various cell types have been used as donors in somatic cell nuclear transfer (SCNT) technology to produce cloned animals from various species (1–4). While previous studies have indicated that the origin of the donor cell used in the cloning procedure is an important determinant of the developmental competence of SCNT embryos (5,6), there is limited information available with regard to the donor cell effect on porcine cloning efficiency.

In addition, the efficiency of producing transgenic cloned animals depends on improving the combination of technologies involved, with the preparation and induction of competent transfected donor cells being a crucial upstream step. However, the genetic modification of donor cells requires long-term culture for adequate cell line establishment, followed by the time required for the transfection procedure. Therefore, the effects of apoptosis and senescence stemming from long-term donor cell culture on SCNT efficiency remain controversial (7,8) and require further evaluation.

In order to address these issues, the present study used four cell lines, two transgenic cell lines and the corresponding non-transfected controls.

Following SCNT, donor cells transfected with a tetracycline on/off responsive gene provide a tool to control the expression of a specific gene at any time during development (9). Therefore, in the present study fibroblasts originating from crossbred Landrace x Yorkshire x Duroc (LYD) pig fibroblasts were transfected with a tetracycline responsive gene. In addition, since triple cell lines appear to be resistant to hyperacute rejection during xenotransplantation procedures (10), an additional fibroblast cell line was used originating from Yucatan mini-pigs and co-transfected with three genes, namely the complement regulatory factors, human decay accelerating factor (hDAF) and human (h) CD59, as well as H-transferase.

Therefore, the objective of the current study was to understand the contribution of transgenic donor cell features to variations in SCNT efficiency. For this purpose, various parameters associated with viability and senescence were compared among four fetal fibroblast cell lines, including morphology, growth rate, mRNA expression and reactive oxygen species (ROS) production.

Materials and methods

Cell lines and culture procedure

Two fetal fibroblast cell lines were used as controls in the study, originating from LYD or Yucatan mini pigs. LYD cells were transfected with a tetracycline-responsive gene (tetracycline on/off cells). Yucatan cells were transfected with the complement regulatory factors, hDAF and hCD59, as well as H-transferase (triple-transfected cells). Thus, each transfected line was compared with its originating control (LYD and Yucatan). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco-BRL, Grand Island, NY, USA) containing 25 μM glucose (high glucose medium) plus 10% fetal bovine serum (FBS; Gibco-BRL). A 130 μg/ml hygromycin B solution from Streptomyces hygroscopious (Sigma-Aldrich, St. Louis, MO, USA) was used for culturing the triple transgenic cell line. Cell cultures were maintained in a 6-well dish and subcultured at a 1:4 ratio once ~90% confluence was observed. The culture medium was replaced every two days. Assays were always performed in cells from the 9th population doubling (PD) passage.

Determination of PD times and cell counts

Following the initial seeding, counting was performed once cells reached 95% confluence. For this purpose, cells were trypsinized, harvested and centrifuged (Hanshin Medical Co., Seoul, Republic of Korea) at 2,000 rpm for 3 min. The pellet was then suspended in DMEM plus 10% FBS and an aliquot was used for counting with a hemocytometer (Superior, Marienfeld, Germany). Cells were seeded again and the entire aforementioned procedure was repeated twice. Thus, PD times were calculated by averaging the time required for the cell number to double during the exponential growth phase, that is, during the three cell subculture from passage 7 to passage 9.

Morphological analysis

Phase contrast microscopy (Leica Microsystems, Wetzlar, Germany) was used to assess cell morphology. Examinations were performed on specimens fixed for 5 min in 4% paraformaldehyde at room temperature.

Quantitative polymerase chain reaction (qPCR)

Total RNA was extracted from the various cell lines using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), according to the manufacturer’s instructions. Complementary DNA (cDNA) was prepared by the reverse transcription of 1 μg total RNA using Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies) and random primers (9-mers; Takara Bio, Inc., Shiga, Japan). qPCR (Mx3000P qPCR System; Agilent Technologies, Inc., Santa Clara, USA) was then performed with 1 μl cDNA template added to 10 μl 2X SYBR Premix Ex Taq (Takara Bio, Inc.) containing specific primers. Amplification was performed for 40 cycles with cycling parameters as follows: Denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec and extension at 72°C for 30 sec. All primer sequences are presented in Table I. The expression of each target gene was quantified relative to that of the internal control gene, GAPDH. The relative quantification was based upon the comparison of the threshold cycle (Ct) at a constant fluorescence intensity. Relative mRNA expression (R) was calculated using the following equation: R = 2−[ΔCtsample − ΔCtcontrol]. To determine the normalized arbitrary value for each gene, values were normalized against GAPDH.

Table I

Primers used for gene expression analysis.

Table I

Primers used for gene expression analysis.

GenePrimer sequences (5′-3′)Product size (bp)GenBank accession number
BaxF: TGCCTCAGGATGCATCTACC
R: AAGTAGAAAAGCGCGACCAC
199XM_003127290
Bcl-2F: AGGGCATTCAGTGACCTGAC
R: CGATCCGACTCACCAATACC
193NM_214285
p53F: CTTTGAGGTGCGTGTTTGTG
R: CGGATCTGGAGGGTGAAATA
192NM_213824
GAPDHF: GTCGGTTGTGGATCTGACCT
R: TTGACGAAGTGGTCGTTGAG
207NM_001206359
Measurement of ROS

To determine the intracellular content of ROS, cells were incubated with 5 μg/ml 2′,7′-dichlorodihydrofluorescein diacetate (H2DCF-DA; Invitrogen Life Technologies) for 30 min at 37°C. The acetates of H2DCF-DA were cleaved by intracellular esterases, releasing the reduced fluorescein, which was then converted to dichlorofluorescein in the presence of ROS and detected by fluorescence activated cell sorting (FACS; Becton Dickinson Immunocytometry Systems, San Jose, CA, USA). Dye-loaded cells were trypsinized for 2 min and the reaction was stopped with phosphate-buffered saline. Living cells were pelleted by centrifugation at 357 × g for 3 min. Following washing with PBS, cells were resuspended in PBS and FACS analysis was performed using emission and excitation wavelengths of 530 and 480 nm, respectively. The detected levels of DCF fluorescence correlated with the ROS levels. Relative levels were compared between the transfected cell lines and their control counterparts.

Statistical analysis

Quantitative measurements were performed at least three times, with data expressed as the mean ± standard error of the mean. Comparisons of mean values between various groups were performed by one-way analysis of variance. P<0.05 was considered to indicate a statistically significant difference.

Results

Cell proliferation rate

For cells in culture, the mean PD time was correlated with the proliferation rate. Mean PD times were 26, 40, 26 and 66 h for the LYD, Yucatan, tetracycline on/off and triple transfected cell lines, respectively. Thus, PD times were longer for LYD than for Yucatan originated fibroblasts. Transgenic tetracycline on/off cell lines had a similar mean PD time to non-transfected LYD fibroblasts, whereas triple transfected cell lines required longer (P<0.05) PD times than non-transfected Yucatan controls.

Morphological analysis

Based on the phase contrast microscopy observations, fibroblasts from Yucatan mini-pigs were larger than those from LYD crossbred pigs, which was consistent with the FACS analysis results (Fig. 1). Conversely, there were no morphological differences between the transfected and corresponding non-transfected controls, with the exception of cell density, as shown by the PD time calculation 3 days following thawing (Figs. 1 and 2).

Figure 1

Scatter plots showing cell viability analysis by flow cytometry of fetal fibroblasts. Fibroblasts from (A) LYD crossbred pigs and (B) Yucatan mini-pigs. (C) LYD fibroblasts transfected with a tetracycline on/off gene. (D) Yucatan fibroblasts transfected with three genes. Images were captured during passage 9. X axis, cell density; Y axis, nuclear density. LYD, Landrace x Yorkshire x Duroc.

Figure 2

Phase contrast photomicrography of fetal fibroblasts. Fibroblasts from (A) LYD crossbred pigs and (B) Yucatan mini-pigs. (C) LYD fibroblasts transfected with a tetracycline on/off gene. (D) Yucatan fibroblasts transfected with three genes. Images were captured during passage 9. LYD, Landrace x Yorkshire x Duroc. 200× magnification.

Gene-expression analysis

To assess cellular aging and apoptosis at the gene level, the mRNA expression levels of TP53, Bax and Bcl-2 were examined in the cell lines. Initially, Yucatan fibroblasts had significantly lower levels of TP53 mRNA and higher levels of Bcl-2 mRNA compared with LYD fibroblasts (Fig. 3A). When comparing tetracycline on/off transgenic cell lines with the original LYD fibroblasts, the former expressed lower levels of Bcl-2 mRNA, with no differences in TP53 or Bax mRNA expression levels (Fig. 3B). In addition, triple transgenic cell lines exhibited a threefold higher TP53 mRNA expression level and a twofold higher Bax mRNA expression level than the non-transfected Yucatan fibroblasts (Fig. 3C).

Figure 3

Relative mRNA expression levels of p53, Bax and Bcl-2 by qPCR analysis. Each bar represents the mean ± standard deviation. (n), no. of replicates. *P<0.01 and **P<0.05, where P-values of (A), (B), and (C) are compared with LYD crossbred, LYD crossbred and Yucatan, respectively. qPCR, quantitative PCR.

ROS production analysis

It has been reported that overproduction of ROS initiates apoptosis (11). Therefore, intracellular ROS levels were evaluated using a DCFH-DA probe (Fig. 4) and FACS analysis (Fig. 5). ROS levels were significantly different depending on cell type and transfection status. The histograms shown correspond to the representative result from three independent experiments (Fig. 5). The rightward shift observed for Yucatan fibroblasts is consistent with more extensive dye oxidation, yielding a relative increase in fluorescence (Fig. 5A). In general, results were consistent with the qualitative differences among cell lines and hence indicated that the two transgenic cell lines exhibited higher intracellular ROS levels when compared with their originating non-transfected cell lines (Fig. 5B and C).

Figure 4

Fluorescent photomicrograph of cultured swine fetal fibroblasts in the 9th passage. (A) LYD, (B) Yucatan and (C) LYD fibroblasts transfected with a tetracycline on/off gene and (D) triple-transfected Yucatan pig fibroblasts. Cells were stained with H2DCFH-DA during passage 9 to assess ROS formation. LYD, Landrace x Yorkshire x Duroc; H2DCFH-DA, 2′,7′-dichlorofluorescin diacetate; ROS, reactive oxygen species.

Figure 5

Histograms showing ROS levels (green fluorescence) analyzed using flow cytometry. Results shown are representative of one of three experiments. ROS, reactive oxygen species.

Discussion

Survival rates of SCNT embryos are reportedly lower in swine than in other domestic species (12). While a number of factors are likely to contribute to the lower success rates, the main reasons for consistent inefficiency of pig cloning remain unclear. A previous study indicated that incomplete remodeling of the donor somatic cell nucleus was a key factor contributing to the low success of SCNT in swines (13). This was in agreement with studies showing that the age, size, gender and type of donor cell may affect the efficiency of SCNT (4,14–16). Moreover, culturing donor cells for long time periods resulted in decreased rates of in vitro embryos and to term development in cattle (17). Altogether, these studies indicate that nuclear donor cell preparation is a crucial step affecting the developmental potential of reconstructed embryos and the successful production of transgenic animals by SCNT. Thus, the present study used four potential donor cell types, based on the breed of origin and transgenic status, and analyzed parameters associated with senescence and apoptosis.

The Bcl-2 family of proteins comprises members with dual functions with regard to positively or negatively regulating apoptosis. For example, Bcl-2 inhibits apoptosis and proliferation, while Bax is pro-apoptotic and proliferative (18). In addition, p53, a protein involved in the regulation of cellular aging, is postulated to inhibit the mammalian target of rapamycin and suppress p21-induced senescence, thus causing quiescence (19). Thus, in the present study, relative expression levels were measured for the aforementioned genes in order to assess cell senescence and/or apoptosis, which may negatively affect the potential of donor cells for SCNT purposes. Notably, the Yucatan cell line exhibited lower expression levels of TP53 mRNA and higher expression levels of Bcl-2 when compared with other cell lines, which correlates with the PD times observed. When compared with LYD fibroblasts, Yucatan cells exhibited a 1.5-fold longer PD time. As for transgenic cells, tetracycline on/off transfected cells exhibited a lower relative expression of antiapoptotic Bcl-2 when compared with the parental LYD cells, indicating that the transfected cells had a diminished ability to avoid an apoptotic event. By comparison, triple-transfected cell lines exhibited significantly higher expression levels of TP53 and Bax when compared with the parental Yucatan fibroblasts. It was therefore hypothesized that this may enhance the probability of these cells undergoing p53-dependent apoptosis, resulting in Bax-driven induction of mitochondrial permeabilization (20). These observations indicate that donor cell transfection may weaken the defense mechanisms against apoptosis or even enforce pathways leading to programmed cell death while in culture. For example, in a study by Li and Gao, CD59 transfected cells underwent caspase-3 activation and apoptosis induction (21). While in this study there was no effect on Bax expression levels, an additional study showed that overexpression of CD59 inhibited antiapoptotic Bcl-2 expression (22). These discrepancies are hypothesized to be due to the differences in cell types; HeLa cells (cervical cancer cells) and breast cancer cells were used in these two studies.

At the cellular level, it has been reported that ROS accelerates telomere shortening and induces senescence (23). Notably, ROS levels increase as cells progress towards senescence through various pathways (24,25). In the present study, a rightward shift was observed in the FACS histogram for Yucatan fibroblasts when compared with LYD cells, which is consistent with ROS accumulation potentially due to aging. Thus, decreased antioxidant capacity may account for a decrease in ROS scavenging, contributing to aging-associated cell oxidative damage (26).

The p53 transcription factor is key in the signal networks of senescence and ROS-induced apoptosis (27,28). In the present study, increased ROS production was observed in transfected cells, indicating that this procedure enhanced aging and apoptosis. In addition, it was reported that p53-mediated senescence (29) and apoptosis (30) are enhanced in modified cells. Thus, the significantly high production of ROS paired with high expression levels of p53 and Bax in triple-transfected cells markedly indicate that ROS-mediated activation of apoptosis may potentially occur via a p53-driven pathway in this cell line. Therefore, ROS may be acting as upstream factors activating TP53, as well as downstream factors targeting p53-mediated Bax activation. The interpretation of the correlation between apoptosis and aging remains controversial. While several studies are consistent with apoptosis being upregulated during senescence in diverse cells, including cardiomyocytes (31), hepatocytes (32) and fibroblasts (33), other studies indicate that oxidative stress does not induce apoptosis in senescent cells (34) and that senescence may attenuate apoptosis (35). The different interpretations may have resulted from the variations in species, strains or cell types used in the respective studies.

Questions remain with regard to assessing the viability of transfected cell lines for use in SCNT. The effect of transfected donor cells upon reconstructed SCNT embryos have been previously reported (36). In the present study, the average number of blastocyst cells was significantly lower for the embryos reconstructed using transfected fibroblasts.

In conclusion, the characteristics of individual transgenic cell types and their associations with senescence and apoptosis following transfection may be important determinants of the developmental ability of SCNT embryos. However, further studies are required to clarify the mechanisms involved.

Acknowledgements

This study was supported by the Basic Science Research Program through the National Research Foundation of Korea, funded by the Ministry of Education, Science and Technology (grant no. 2012004885). The authors would like to thank the Sooam Biotech Research Foundation for the donation of the cell lines (Yucatan fibroblasts and triple-transfected cells).

Reference

1 

Kato Y, Tani T, Sotomaru Y, Kurokawa K, Kato J, Doguchi H, et al: Eight calves cloned from somatic cells of a single adult. Science. 282:2095–2098. 1998. View Article : Google Scholar : PubMed/NCBI

2 

Lee BC, Kim MK, Jang G, Oh HJ, Yuda F, Kim HJ, et al: Dogs cloned from adult somatic cells. Nature. 436:6412005. View Article : Google Scholar : PubMed/NCBI

3 

Galli C, Lagutina I, Crotti G, Colleoni S, Turini P, Ponderato N, et al: Pregnancy: a cloned horse born to its dam twin. Nature. 424:6352003. View Article : Google Scholar : PubMed/NCBI

4 

Wakayama T and Yanagimachi R: Mouse cloning with nucleus donor cells of different age and type. Mol Reprod Dev. 58:376–383. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Oback B and Wells D: Practical aspects of donor cell selection for nuclear cloning. Cloning Stem Cells. 4:169–174. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Batchelder CA, Hoffert KA, Bertolini M, Moyer AL, Mason JB, Petkov SG, et al: Effect of the nuclear-donor cell lineage, type, and cell donor on development of somatic cell nuclear transfer embryos in cattle. Cloning Stem Cells. 7:238–254. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Kubota C, Yamakuchi H, Todoroki J, Mizoshita K, Tabara N, Barber M and Yang X: Six cloned calves produced from adult fibroblast cells after long-term culture. Proc Natl Acad Sci USA. 97:990–995. 2000. View Article : Google Scholar : PubMed/NCBI

8 

Roh S, Shim H, Hwang WS and Yoon JT: In vitro development of green fluorescent protein (GFP) transgenic bovine embryos after nuclear transfer using different cell cycles and passages of fetal fibroblasts. Reprod Fertil Dev. 12:1–6. 2000. View Article : Google Scholar

9 

Zhu Z, Zheng T, Lee CG, Homer RJ and Elias JA: Tetracycline-controlled transcriptional regulation systems: advances and application in transgenic animal modeling. Semin Cell Dev Biol. 13:121–128. 2002. View Article : Google Scholar : PubMed/NCBI

10 

Ramírez P, Montoya MJ, Ríos A, García Palenciano C, Majado M, Chávez R, et al: Prevention of hyperacute rejection in a model of orthotopic liver xenotransplantation from pig to baboon using polytransgenic pig livers (CD55, CD59, and H-transferase). Transplant Proc. 37:4103–4106. 2005.PubMed/NCBI

11 

Circu ML and Aw TY: Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic Biol Med. 48:749–762. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Pratt SL, Sherrer ES, Reeves DE and Stice SL: Factors influencing the commercialisation of cloning in the pork industry. Soc Reprod Fertil Suppl. 62:303–315. 2006.PubMed/NCBI

13 

Zhao J, Whyte J and Prather RS: Effect of epigenetic regulation during swine embryogenesis and on cloning by nuclear transfer. Cell Tissue Res. 341:13–21. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Yang F, Hao R, Kessler B, Brem G, Wolf E and Zakhartchenko V: Rabbit somatic cell cloning: effects of donor cell type, histone acetylation status and chimeric embryo complementation. Reproduction. 133:219–230. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Hosseini SM, Moulavi F, Foruzanfar M, Hajian M, Abedi P, Rezazade-Valojerdi M, et al: Effect of donor cell type and gender on the efficiency of in vitro sheep somatic cell cloning. Small Rumin Res. 78:162–168. 2008. View Article : Google Scholar

16 

Zhang YH, Song ES, Kim ES, Cong PQ, Lee SH, Lee JW, et al: Effects of donor cell passage, size and type on development of porcine embryos derived from somatic cell nuclear transfer. Asian-Aust J Anim Sci. 22:194–200. 2009. View Article : Google Scholar

17 

Hill JR, Winger QA, Long CR, Looney CR, Thompson JA and Westhusin ME: Development rates of male bovine nuclear transfer embryos derived from adult and fetal cells. Biol Reprod. 62:1135–1140. 2000. View Article : Google Scholar : PubMed/NCBI

18 

Zinkel S, Gross A and Yang E: BCL2 family in DNA damage and cell cycle control. Cell Death Differ. 13:1351–1359. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Leontieva OV and Blagosklonny MV: DNA damaging agents and p53 do not cause senescence in quiescent cells, while consecutive re-activation of mTOR is associated with conversion to senescence. Aging (Albany NY). 2:924–935. 2010.PubMed/NCBI

20 

Basu A and Haldar S: The relationship between BcI2, Bax and p53: consequences for cell cycle progression and cell death. Mol Hum Reprod. 4:1099–1109. 1998. View Article : Google Scholar : PubMed/NCBI

21 

Li XP and Gao MH: Effect of peptide seals specific to CD59 on the expression of apoptosis-related genes in HeLa cells. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 24:20–22. 2008.(In Chinese).

22 

Li B, Chu X, Gao M and Xu Y: The effects of CD59 gene as a target gene on breast cancer cells. Cell Immunol. 272:61–70. 2011. View Article : Google Scholar : PubMed/NCBI

23 

von Zglinicki T: Oxidative stress shortens telomeres. Trends Biochem Sci. 27:339–344. 2002.PubMed/NCBI

24 

Passos JF and Von Zglinicki T: Oxygen free radicals in cell senescence: are they signal transducers? Free Radic Res. 40:1277–1283. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Terada LS: Specificity in reactive oxidant signaling: think globally, act locally. J Cell Biol. 174:615–623. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Lu CY, Lee HC, Fahn HJ and Wei YH: Oxidative damage elicited by imbalance of free radical scavenging enzymes is associated with large-scale mtDNA deletions in aging human skin. Mutat Res. 423:11–21. 1999. View Article : Google Scholar : PubMed/NCBI

27 

Vigneron A and Vousden KH: p53, ROS and senescence in the control of aging. Aging (Albany NY). 2:471–474. 2010.PubMed/NCBI

28 

Li PF, Dietz R and von Harsdorf R: p53 regulates mitochondrial membrane potential through reactive oxygen species and induces cytochrome c-independent apoptosis blocked by Bcl-2. EMBO J. 18:6027–6036. 1999. View Article : Google Scholar

29 

Maier B, Gluba W, Bernier B, Turner T, Mohammad K, Guise T, et al: Modulation of mammalian life span by the short isoform of p53. Genes Dev. 18:306–319. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann H, et al: p53 mutant mice that display early ageing-associated phenotypes. Nature. 415:45–53. 2002. View Article : Google Scholar : PubMed/NCBI

31 

Kajstura J, Cheng W, Sarangarajan R, Li P, Li B, Nitahara JA, et al: Necrotic and apoptotic myocyte cell death in the aging heart of Fischer 344 rats. Am J Physiol. 271:H1215–H1228. 1996.PubMed/NCBI

32 

Muskhelishvili L, Hart RW, Turturro A and James SJ: Age-related changes in the intrinsic rate of apoptosis in livers of diet-restricted and ad libitum-fed B6C3F1 mice. Am J Pathol. 147:20–24. 1995.PubMed/NCBI

33 

Kujoth GC, Hiona A, Pugh TD, Someya S, Panzer K, Wohlgemuth SE, et al: Mitochondrial DNA mutations, oxidative stress, and apoptosis in mammalian aging. Science. 309:481–484. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Gansauge S, Gansauge F, Gause H, Poch B, Schoenberg MH and Beger HG: The induction of apoptosis in proliferating human fibroblasts by oxygen radicals is associated with a p53- and p21WAF1CIP1 induction. FEBS Lett. 404:6–10. 1997. View Article : Google Scholar : PubMed/NCBI

35 

Xiao ZQ, Moragoda L, Jaszewski R, Hatfield JA, Fligiel SE and Majumdar AP: Aging is associated with increased proliferation and decreased apoptosis in the colonic mucosa. Mech Ageing Dev. 122:1849–1864. 2001. View Article : Google Scholar : PubMed/NCBI

36 

Kurome M, Ishikawa T, Tomii R, Ueno S, Shimada A, Yazawa H and Nagashima H: Production of transgenic and non-transgenic clones in miniature pigs by somatic cell nuclear transfer. J Reprod Dev. 54:156–63. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kim E and Hyun SH: Comparative analysis of various donor cell types for somatic cell nuclear transfer and its association with apoptosis and senescence. Mol Med Rep 9: 63-68, 2014.
APA
Kim, E., & Hyun, S. (2014). Comparative analysis of various donor cell types for somatic cell nuclear transfer and its association with apoptosis and senescence. Molecular Medicine Reports, 9, 63-68. https://doi.org/10.3892/mmr.2013.1776
MLA
Kim, E., Hyun, S."Comparative analysis of various donor cell types for somatic cell nuclear transfer and its association with apoptosis and senescence". Molecular Medicine Reports 9.1 (2014): 63-68.
Chicago
Kim, E., Hyun, S."Comparative analysis of various donor cell types for somatic cell nuclear transfer and its association with apoptosis and senescence". Molecular Medicine Reports 9, no. 1 (2014): 63-68. https://doi.org/10.3892/mmr.2013.1776
Copy and paste a formatted citation
x
Spandidos Publications style
Kim E and Hyun SH: Comparative analysis of various donor cell types for somatic cell nuclear transfer and its association with apoptosis and senescence. Mol Med Rep 9: 63-68, 2014.
APA
Kim, E., & Hyun, S. (2014). Comparative analysis of various donor cell types for somatic cell nuclear transfer and its association with apoptosis and senescence. Molecular Medicine Reports, 9, 63-68. https://doi.org/10.3892/mmr.2013.1776
MLA
Kim, E., Hyun, S."Comparative analysis of various donor cell types for somatic cell nuclear transfer and its association with apoptosis and senescence". Molecular Medicine Reports 9.1 (2014): 63-68.
Chicago
Kim, E., Hyun, S."Comparative analysis of various donor cell types for somatic cell nuclear transfer and its association with apoptosis and senescence". Molecular Medicine Reports 9, no. 1 (2014): 63-68. https://doi.org/10.3892/mmr.2013.1776
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team