Open Access

Vitamin D/VDR signaling attenuates lipopolysaccharide‑induced acute lung injury by maintaining the integrity of the pulmonary epithelial barrier

  • Authors:
    • Yong‑Yan Shi
    • Tian‑Jing Liu
    • Jian‑Hua Fu
    • Wei Xu
    • Lin‑Lin Wu
    • A‑Na Hou
    • Xin‑Dong Xue
  • View Affiliations

  • Published online on: December 14, 2015     https://doi.org/10.3892/mmr.2015.4685
  • Pages: 1186-1194
  • Copyright: © Shi et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Vitamin D and its receptor have a protective effect on epithelial barriers in various tissues. Low levels of vitamin D are associated with numerous pulmonary diseases, including acute lung injury (ALI) and acute respiratory distress syndrome. The present study investigated whether the vitamin D/vitamin D receptor (VDR) pathway may ameliorate lipopolysaccharide (LPS)‑induced ALI through maintaining the integrity of the alveolar epithelial barrier. This was investigated by exposing wild‑type (WT) and VDR knockout C57BL/6J mice to LPS, then comparing the healthy and LPS‑treated mice lungs and bronchoalveolar lavage fluid (BALF). More specifically, lung histology, mRNA levels of proinflammatory cytokines and chemokines, and protein expression levels of tight junction proteins were determined. In addition, a vitamin D analog (paricalcitol) was administered to WT mice in order to investigate the effect of vitamin D on the alveolar epithelial barrier following exposure to LPS. VDR knockout mice exhibited severe lung injuries (P<0.001), increased alveolar permeability [demonstrated by a higher wet‑dry ratio of lung weight (P<0.05), greater expression levels of BALF protein (P<0.001) and fluorescein isothiocyanate‑conjugated 4 kDa dextran (P<0.001) leakage into the alveolar space], elevated proinflammatory cytokine and chemokine mRNA levels, as demonstrated by reverse transcription‑quantitative polymerase chain reaction (P<0.05), and decreased protein and mRNA expression levels of occludin (P<0.01) and zonula occludens‑1 (ZO‑1; P<0.01) compared with WT mice. Paricalcitol treatment partially inhibited these pathological changes in WT mice by maintaining the mRNA and protein expression levels of occludin (P<0.01) and ZO‑1 (P<0.05). A lack of VDRs in the pulmonary epithelial barrier appeared to compromise its defense, leading to more severe LPS‑induced lung injury. Furthermore, vitamin D treatment alleviated LPS‑induced lung injury and preserved alveolar barrier function. Therefore vitamin D treatment may present as a potential therapeutic strategy in ALI and acute respiratory distress syndrome.

Introduction

Acute lung injury (ALI) and its more severe form, acute respiratory distress syndrome (ARDS), contribute to morbidity and mortality in critically ill patients, with rates of morbidity and mortality of 75/100,000 and 40–60%, respectively (1,2). In particular, gram-negative sepsis often leads to ALI/ARDS (3). ALI/ARDS are characterized by an extensive inflammatory process leading to diffuse alveolar damage, an influx of neutrophils, activation of proinflammatory cytokines and chemokines, macrophages and protein-rich exudate in the alveolar space due to the disruption of the alveolar epithelial barrier (1,2).

The active form of vitamin D, termed calcitriol or 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3], binds to the vitamin D receptor (VDR), a member of the nuclear hormone receptor superfamily (4). In addition to regulating calcium, vitamin D acts as a regulator of multiple biological processes, including anti-inflammation, immunomodulation and barrier function maintenance (5). Furthermore, it has been suggested that the production of 1,25-(OH)2D3 is evidence of a local paracrine/autocrine action in various tissues (6), including pulmonary epithelial cells (7). There is growing evidence in support of associations between vitamin D deficiency, and impaired pulmonary function (8), an increased incidence of ALI/ARDS (912) and inflammatory diseases, including asthma (13), tuberculosis (14) and chronic obstructive pulmonary disease (COPD) (8,15). Previous studies have suggested that vitamin D deficiency is also common in critically ill patients (9,10), and is often associated with increased morbidity and mortality, including that caused by ALI/ARDS (912,16,17). However, the underlying mechanism of vitamin D/VDR signaling and sepsis-induced ALI/ARDS has yet to be investigated.

Vitamin D/VDR signaling is important for the integrity of tissue barriers and anti-inflammatory functions (5,6). It has been demonstrated to regulate the components of tight junctions and maintain the integrity of epithelial barriers in multiple organs, including the skin (18), eyes (19) and large intestine (20). In lungs, the permeability of the alveolar epithelial barrier is largely regulated by the intercellular junctions that seal the paracellular space (21,22). Disruption of the epithelial barrier may increase alveolar permeability and result in paracellular movements of fluid from the interstitium to the pulmonary airspace, as well as infiltration of inflammatory cells. Subsequent pulmonary edema impairs blood-gas exchange, leading to ARDS. Preserving or restoring these barriers may provide a therapeutic strategy for preventing or treating ALI/ARDS (23,24). However, to the best of our knowledge, there has been no previous investigation regarding vitamin D/VDR signaling regulation of the alveolar epithelial barrier in the lungs.

The aim of the present study was to investigate the effect of VDR knockout on lipopolysaccharide (LPS)-induced ALI and to assess the effect of vitamin D treatment on LPS-induced ALI in a mouse model. The results suggested that mice lacking VDR had a compromised alveolar epithelial barrier and aggravated ALI. Furthermore, it was identified that vitamin D treatment may sustain the integrity of the barrier and thus attenuate ALI.

Materials and methods

Ethics statement

All experimental procedures were reviewed and approved by the Institutional Ethics Committee of China Medical University (Shenyang, China).

Animals

VDR heterozygous (VDR+/−) mice with a C57BL/6J background (6 weeks old) were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). VDR heterozygous males and females were bred to generate wild-type (WT; VDR+/+) and VDR knockout (KO; VDR−/−) mice for the experiment. All mice were kept in pathogen-free cages with a 12-h light/dark cycle, and fed a rescue diet high in calcium, phosphate and lactose (Envigo; Madison, WI, USA) to maintain a normal plasma calcium level in VDR KO mice (25).

Genotyping

Total DNA was harvested from the mouse tails and primers were provided by The Jackson Laboratory. Polymerase chain reaction (PCR) was performed as follows: Pre-denaturation at 94°C for 5 min; followed by 35 cycles of 94°C for 30 sec, 55°C for 30 sec, 72°C for 40 sec, 72°C for 10 min, and held at 4°C until electrophoresis. Agarose gel electrophoresis was performed with 2% agarose (in TAE buffer; Beyotime Institute of Biotechnology) at 100 V until the bands were clearly separated.

Treatment groups

Two mice (age, 8–12 weeks) per gender were selected for each treatment group. LPS [Lipopolysaccharides from Escherichia coli 0111:B4, dissolved in phosphate-buffered saline (PBS)] from Sigma-Aldrich (St. Louis, MO, USA) was injected once intratracheally (10 mg/kg) in WT and KO mice. The control group was comprised of KO and WT mice injected with the same volume of sterile PBS. Bronchoalveolar lavage fluid (BALF) was collected. Briefly, following anesthesia by intraperitoneal injection with a cocktail of xylazine (Rompun 2%; Bayer AG, Leverkusen, Germany) and ketamine (Ketavest; 100 mg/ml; Pfizer, Inc., New York, NY, USA), the trachea was exposed and the lungs were lavaged three times with 0.2 ml sterile saline per wash. The BALF was stored at 4°C and samples of lung tissue were harvested for RNA, protein and histological studies 12 h after treatment, and refrigerated at −80°C.

WT mice were randomly divided into four treatment groups. Two vitamin D treatment groups (one PBS group and one LPS group) were treated with the vitamin D analog paricalcitol (Sigma-Aldrich) dissolved in propylene (glycol:ethanol, 90:10; 0.5 µg/kg body weight) through intra-peritoneal injection 30 min prior to LPS or PBS treatment. The two vehicle groups received the dissolvent only prior to LPS or PBS treatment.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was isolated from the lung tissues using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). First-strand cDNAs were synthesized using a PrimeScript RT reagent kit (Takara Biotechnology Co., Ltd., Dalian, China) and PCR was performed with the 20-µl volume reaction mixture using a SYBR-Green PCR reagent kit (Clontech Laboratories, Inc., Mountainview, CA, USA) on a LightCycler 480 Real-Time PCR system (Roche Diagnostics, Basel, Switzerland). The cycling conditions were as follows: 50°C for 2 min and 95°C for 2 min, followed by 40 cycles of: 95°C for 15 sec, 55°C for 15 sec, 72°C for 1 min and 72°C for 1 min. Relative transcripts of mRNA were calculated using the quantification cycle (Cq) 2−ΔΔCq formula (26). β-2 micro-globulin served as an internal control. Sequences of the PCR primers are provided in Table I.

Table I

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Table I

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Primer nameForward (5′→3′)Reverse (5′→3′)
Mouse TNF-α ATGAGCACAGAAAGCATGA AGTAGACAGAAGAGCGTGGT
Mouse IL-6 CCTCTGGTCTTCTGGAGTACC ACTCCTTCTGTGACTCCAGC
Mouse IL-1β AATGAAAGACGGCACACCCA TGCTTGTGAGGTGCTGATGT
Mouse IFN-γ TTCTTCAGCAACAGCAAGGC TCAGCAGCGACTCCTTTTCC
Mouse MCP-1 GCTCAGCCAGATGCAGTTAA TCTTGAGCTTGGTGACAAAAACT
Mouse MIP-2 TGAACTGCGCTGTCAATGC GCTTCAGGGTCAAGGCAAAC
Mouse occludin CTACGGAGGTGGCTATGGAG AGCGCTGACTATGATCACGA
Mouse ZO-1 ACGATCTCCTGACCAACGTT GCTTTGGGTGGATGATCGTC
Mouse B2M CGGCCTGTATGCTATCCAGA GGGTGAATTCAGTGTGAGCC

[i] TNF-α, tumor necrosis factor; IL-6, interleukin; IL-1β, interleukin β, IFN-γ, interferon; MCP-1, monocyte chemoattractant protein; MIP-2, macrophage inflammatory protein; ZO-1, zonula occludens-1; B2M, β2 microglobulin.

Western blot analysis

Following anesthesia, the chests of the mice were opened and the lung was harvested and homogenized in RIPA buffer (Beyotime Institute of Biotechnology, Haimen, China). The supernatant was used to measure protein concentration according to the BCA method (Biorad Laboratories, Inc., Hercules, CA, USA). SDS (3X) was subsequently added and the mixture was heated to 95°C for 5 mins. The proteins (50 µg per lane) were electrophoresed on 10% SDS-PAGE (80 V for 30 min in condensed gel and 120 V for 90 min in dissociated gel), separated by 10% SDS-PAGE gels and electroblotted onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA) at 90 V for 90 min. The density of the bands were quantitated using ImageJ software (version 1.47; National Institutes of Health, Bethesda, MD, USA) and normalized to that of β-actin. The following primary antibodies were used: Polyclonal, anti-rabbit VDR (cat. no. C20; 1:1,000 dilution; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), monoclonal, anti-mouse β-actin (cat. no. A5316; 1:10,000 dilution; Sigma-Aldrich), monoclonal, anti-mouse zonula occludens-1 (ZO-1; cat. no. 339100; 1:2,000 dilution; Cell Signaling Technology, Inc., Danvers MA, USA) and monoclonal, anti-mouse occludin (cat. no. 331500; 1:2,000 dilution; Cell Signaling Technology, Inc.). The PVDF membranes were incubated at room temperature for 1 h in 5% Tris-buffered saline and Tween-20 (TBST) with non-fat milk to block non-specific binding, then incubated overnight at 4°C with the primary antibodies. After washing three times in 0.1% TBST, the membranes were incubated at room temperature for 60 min with horseradish peroxidase-conjugated secondary antibodies (goat anti-rabbit and anti-mouse IgG-HRP; cat. nos. sc-2004 and sc-2005, respectively; 1:2,000 dilution; Santa Cruz Biotechnology, Inc.). The membrane was then washed three times in 0.1% TBST.

Histology and immunofluorescence

The mice lungs were harvested and the right lung was placed in 4% formalin overnight, dehydrated with graded alcohol, placed in xylene for 1 h and then embedded in paraffin at 60°C. Sections of the lung tissues (4 µm) were stained with hematoxylin and eosin (H&E; Beyotime Institute of Biotechnology) at room temperature. The lung morphology resulting from the different treatments was scored according to H&E stained slides using a novel acute lung injury scoring system (27). A total of five random fields were selected and the evaluation was completed by two pathologists blinded to the study design. To localize the expression of tight junction proteins, sections were incubated with the anti-ZO-1 (1:200 dilution) or anti-occludin (1:200 dilution) antibodies, and were subsequently conjugated with Alexa Fluor 555 or 488 secondary antibodies (Invitrogen; Thermo Fisher Scientific, Inc.). Antigens were visualized using a Leica DFC425 fluorescence microscope [Leica Microsystems (Schweiz) AG, Heerbrugg, Switzerland].

Assessment of lung injury

The wet-dry ratio of lung weight was measured, as previously described (21). Briefly, the left lung was excised and the wet weight was measured using a Genimi-20 Portable Milligram Scale (American Weigh Scales, Inc., Norcross, GA, USA), the lung was then dried in an oven at 85°C for 72 h and weighed dry. The wet-dry ratio was calculated as follows: Wet lung weight/dry lung weight. The BALF protein concentration was determined using a DC Protein Assay kit (Bio-Rad Laboratories, Inc.), according to the manufacturer's protocol. Myeloperoxidase (MPO) activity was analyzed using a Myeloperoxidase Activity Assay kit, according to the manufacturer's protocol (CytoStore, Inc., Alberta, Canada) and an M200 microplate system (Tecan Group Ltd., Männedorf, Switzerland) was used to measure the optical density. In addition, the BALF to serum fluorescence ratio of fluorescein isothiocyanate-conjugated 4 kDa dextran (FD4; Sigma-Aldrich) was calculated to evaluate the pulmonary permeability, as previously described (21).

Statistical analysis

All continuous data are presented as the mean ± standard deviation. Statistical comparison of continuous variables between groups was performed using Student's t-test or one-way analysis of variance with GraphPad Prism (version 6.0; GraphPad Software, Inc., La Jolla, CA, USA) and Statistical Product and Service Solutions (version 17.0; SPSS, Inc., Chicago, IL, USA). P<0.05 indicated a statistically significant difference.

Results

VDR KO mice exhibit more severe LPS-induced ALI than VDR WT mice

VDR WT and KO mice were bred and genotyped according to the protocol of The Jackson Laboratories. Genotype and VDR expression were confirmed using the lung lysates (Fig. 1A and B). The lungs of VDR KO mice appeared more injured and congested following LPS treatment compared with VDR WT mice (Fig. 1C). VDR KO mice also exhibited more severe interstitial edema, alveolar wall thickening and inflammatory cells infiltration compared with WT mice (Fig. 1D). Furthermore, ALI scores of VDR KO mice were significantly higher than VDR WT mice following LPS treatment (P<0.001; Fig. 1E).

In mice lacking VDR, pulmonary permeability was increased and MPO activity was higher. More specifically, a significantly higher wet-dry lung ratio was observed (P<0.05; Fig. 2A) in VDR KO mice subsequent to LPS exposure compared with WT mice, indicating that more fluid was retained in the VDR KO lung. VDR KO mice were also identified to have higher expression levels of BALF protein (Fig. 2B; P<0.001), and greater FD4 leakage from the lung interstitium or capillaries into the alveolar space (Fig. 2C; P<0.001) compared with VDR WT mice. Furthermore, exposure to LPS induced significantly higher MPO activity in the lungs of VDR KO mice compared with VDR WT mice (P<0.001; Fig. 2D).

VDR KO leads to severe lung inflammation

To further investigate the anti-inflammatory effect of VDR in lungs, the levels of proinflammatory cytokines and chemokines were determined. RT-qPCR indicated that the mRNA expression levels of proinflammatory cytokines and chemokines were significantly higher in VDR KO mice compared with VDR WT mice following LPS treatment (Fig. 3).

VDR KO decreases the expression of pulmonary epithelial tight junction proteins, occludin and ZO-1

Following exposure to LPS, mRNA (Fig. 4A) and protein (Fig. 4B) expression levels of occludin and ZO-1 were significantly lower in VDR KO mice compared with VDR WT mice (P<0.01). Furthermore, LPS treatment resulted in lower levels of expression of occludin (Fig. 4C) and ZO-1 (Fig. 4D) in the alveolar epithelial cells of all mice treated with LPS, with VDR KO mice demonstrating a more severely disrupted expression pattern than VDR WT mice. Therefore, the lack of VDR may compromise the function of the pulmonary barrier by decreasing the expression of occludin and ZO-1.

Vitamin D analog treatment alleviates LPS-induced ALI by preserving occludin and ZO-1 expression

Histological examination of LPS-exposed vehicle mice revealed a considerable infiltration of inflammatory cells and thickening of the alveolar wall. However, in mice treated with vitamin D analog prior to LPS exposure, pulmonary inflammation and the thickening of the alveolar wall was less apparent (Fig. 5A). This was accompanied by a significantly decreased ALI score in the vitamin D pretreated mice compared with the vehicle treated mice (P<0.001; Fig. 5B). MPO activity was also significantly lower in VD mice (P<0.05; Fig. 5C). The induction of proinflammatory cytokine and chemokine expression was significantly suppressed by vitamin D treatment (Fig. 6A and B). Furthermore, animals pretreated with vitamin D experienced significantly less severe pulmonary edema (P<0.05; Fig. 6C) and lower levels of BALF protein debris entering the alveolar space (P<0.01; Fig. 6D) compared with VE mice. Vitamin D pretreated mice exhibited significantly higher mRNA (Fig. 7A) and protein (Fig. 7B) expression levels of occludin and ZO-1 compared with vehicle treated mice. This may be due to VDR decreasing the permeability of the pulmonary epithelial barrier, thus limiting the pathological changes that occur during ALI.

Discussion

Vitamin D deficiency impairs lung function and has been associated with a number of lung diseases, including COPD, asthma, tuberculosis, ALI and its severe form, ARDS (817); however the underlying mechanisms of these associations remain unclear. The present study demonstrated that VDR null mice exhibit more severe LPS-induced ALI, primarily due to deterioration of the alveolar epithelial tight junctions through a decrease in occludin and ZO-1 expression. By contrast, vitamin D treatment alleviated lung injury through maintenance of the pulmonary barrier. To the best of our knowledge, this was the first study to investigate the protective function of the vitamin D/VDR signaling pathway on the pulmonary epithelial barrier.

ARDS remains a major cause of morbidity and mortality in critically ill patients (13). It is characterized by the disruption of the endothelial and epithelial barriers of alveoli, leading to increased barrier permeability (1,2). The alveolar epithelial barrier consists of a monolayer of epithelial cells with intercellular junctions that seal the paracellular space and regulate barrier permeability (21,22). Preserving or restoring the barrier function of alveolar epithelial cells may be a novel treatment for sepsis-induced ARDS. Tight junction complexes are composed of integral membrane proteins, cytoplasmic plaque proteins and cytoskeletal proteins (28). Among these, occludin and ZO-1 are key components that regulate paracellular permeability. They are indispensible in alveolar epithelial barrier function and fluid clearance (21). Reduced or dysmorphic expression of occludin and ZO-1 may compromise the alveolar barrier function and result in increased alveolar permeability, thus impairing blood-gas exchange. In a previous study, hyperoxia was identified to disrupt the pulmonary epithelial barrier in newborn rats by decreasing occludin and ZO-1 levels (21). Therefore, disruption of the alveolar epithelial barrier is a critical factor in the pathogenesis of lung injuries and subsequent pathological changes; however, the molecular mechanisms that influence components of the tight junction remain poorly understood.

The active form of vitamin D is 1,25-(OH)2D3, and is important in maintaining the structure and function of epithelial barriers in multiple tissues (1820). The administration of 1,25-(OH)2D3 as part of a therapeutic regimen may revert proteinuria and inhibit glomerular podocytes injury, partially through improving the barrier function in the kidneys (29). VDR null mice are more susceptible to colonic injury induced by dextran sulfate sodium compared with WT mice, as the lack of VDR compromises the intestinal epithelial barrier structure (20). Thus, the vitamin D/VDR signaling pathway may be a target in the treatment of various inflammatory diseases through preserving or restoring epithelial barrier function. In the present study, VDR KO mice exhibited more severe ALI induced by LPS compared with WT mice. Furthermore, occludin and ZO-1 levels in VDR KO mice were lower compared with WT mice. This led to greater infiltration of inflammatory cells, release of proinflammatory cytokines and chemokines, and fluid retention. However, vitamin D treatment may partly reverse this pathological process. The present study indicates that vitamin D/VDR signaling may inhibit endotoxin-induced ALI through maintaining the integrity of pulmonary epithelial barrier.

Neutrophil recruitment is important in the progression of ALI and ARDS (30). The infiltration of neutrophils may be evaluated through MPO activity. In the present study, VDR KO mice exposed to LPS exhibited higher MPO activity in the lung lysates compared with WT mice. When vitamin D pretreatment was applied, lower MPO activity was observed. In agreement with these results, a previous study used a hamster model of ALI to identify that 1,25-(OH)2D3 inhibits neutrophil recruitment by 40%, due to its inhibitory effect on interleukin-8 (IL-8) (30). The alveolar barrier limits neutrophil infiltration, thus the inhibitory effect of neutrophil recruitment by vitamin D/VDR signaling may be partly due to the maintenance of the integrity of the alveolar barrier.

Furthermore, lung epithelial cells had been identified to express high baseline levels of 1α-hydroxylase, which activates vitamin D, and low levels of inactivating 24-hydroxylase (7). Active vitamin D generated by lung epithelial cells is important for innate immune functions (7). During sepsis, pro-inflammatory cytokines and chemokines are produced by activated alveolar macrophages in the air space. Tumor necrosis factor-α (TNF-α), IL-6 and IL-1β proteins are also important as they mediate, amplify and promote the process of lung inflammation (1). These cascades of immune responses result in various stages of alveolar epithelial injury (1). Furthermore, 1,25-(OH)2D3 may ameliorate seawater-aspiration induced ALI through the inhibition of nuclear factor-κB and the RhoA/Rho kinase signaling pathways (31). In addition, it may also alleviate lung damage secondary to ischemia reperfusion injury (32). The present study identified that LPS treatment increased the expression levels of the following cytokines and chemokines in WT mice: TNF-α, IL-6, IL-1β, interferon-γ, monocyte chemoattractant protein-1 and macrophage inflammatory protein-2. This effect was even more apparent in VDR KO mice, thus confirming that the VDR KO lung was markedly more inflamed than the WT lung. By contrast, vitamin D treatment substantially inhibited the build-up of chemokines and attenuated LPS-induced lung injury. Furthermore, the present study determined that active vitamin D was capable of triggering an anti-inflammatory defense and preserving the structural barrier in the lungs.

In conclusion, the current study highlights that lack of VDR may compromise the pulmonary epithelial barrier defense, leading to a more severe LPS-induced lung injury. Furthermore, vitamin D treatment may preserve the alveolar barrier function and therefore alleviate LPS-induced lung injury. These observations provide further insight into the pathogenesis of ALI/ARDS and emphasize that vitamin D may be a novel treatment for ALI/ARDS.

Acknowledgments

This study was supported by the National Natural Science Foundation of China (grant nos. 81170605, 81471489, 81271938, 81270726) and the Outstanding Scientific Fund of Sheng Jing Hospital (Shenyang, China).

References

1 

Ware LB and Matthay MA: The acute respiratory distress syndrome. N Engl J Med. 342:1334–1339. 2000. View Article : Google Scholar : PubMed/NCBI

2 

Parekh D, Dancer RC and Thickett DR: Acute lung injury. Clin Med. 11:615–618. 2011. View Article : Google Scholar

3 

Matthay MA, Zimmerman GA, Esmon C, Bhattacharya J, Coller B, Doerschuk CM, Floros J, Gimbrone MA Jr, Hoffman E, Hubmayr RD, et al: Future research directions in acute lung injury: Summary of a National Heart, Lung, and Blood Institute working group. Am J Respir Crit Care Med. 167:1027–1035. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Haussler MR, Whitfield GK, Haussler CA, Hsieh JC, Thompson PD, Selznick SH, Dominguez CE and Jurutka PW: The nuclear vitamin D receptor: Biological and molecular regulatory properties revealed. J Bone Miner Res. 13:325–349. 1998. View Article : Google Scholar : PubMed/NCBI

5 

Bouillon R, Carmeliet G, Verlinden L, van Etten E, Verstuyf A, Luderer HF, Lieben L, Mathieu C and Demay M: Vitamin D and human health: Lessons from vitamin D receptor null mice. Endocr Rev. 29:726–776. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Adams JS and Hewison M: Update in vitamin D. J Clin Endocrinol Metab. 95:471–478. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Hansdottir S, Monick MM, Hinde SL, Lovan N, Look DC and Hunninghake GW: Respiratory epithelial cells convert inactive vitamin D to its active form: Potential effects on host defense. J Immunol. 181:7090–7099. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Afzal S, Lange P, Bojesen SE, Freiberg JJ and Nordestgaard BG: Plasma 25-hydroxyvitamin D, lung function and risk of chronic obstructive pulmonary disease. Thorax. 69:24–31. 2014. View Article : Google Scholar

9 

Rippel C, South M, Butt WW and Shekerdemian LS: Vitamin D status in critically ill children. Intensive Care Med. 38:2055–2062. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Lee P, Eisman JA and Center JR: Vitamin D deficiency in critically ill patients. N Engl J Med. 360:1912–1914. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Barnett N, Zhao Z, Koyama T, Janz DR, Wang CY, May AK, Bernard GR and Ware LB: Vitamin D deficiency and risk of acute lung injury in severe sepsis and severe trauma: A case-control study. Ann Intensive Care. 4:5–14. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Parekh D, Dancer RC, Lax S, Cooper MS, Martineau AR, Fraser WD, Tucker O, Alderson D, Perkins GD, Gao-Smith F and Thickett DR: Vitamin D to prevent acute lung injury following oesophagectomy (VINDALOO): Study protocol for a randomised placebo controlled trial. Trials. 14:100–106. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Hollams EM, Hart PH, Holt BJ, Serralha M, Parsons F, de Klerk NH, Zhang G, Sly PD and Holt PG: Vitamin D and atopy and asthma phenotypes in children: A longitudinal cohort study. Eur Respir J. 38:1320–1327. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Wilkinson RJ, Llewelyn M, Toossi Z, Patel P, Pasvol G, Lalvani A, Wright D, Latif M and Davidson RN: Influence of vitamin D deficiency and vitamin D receptor polymorphisms on tuberculosis among Gujarati Asians in west London: A case-control study. Lancet. 355:618–621. 2000. View Article : Google Scholar : PubMed/NCBI

15 

Persson LJ, Aanerud M, Hiemstra PS, Hardie JA, Bakke PS and Eagan TM: Chronic obstructive pulmonary disease is associated with low levels of vitamin D. PLoS One. 7:e38934–e38941. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Amrein K, Zajic P, Schnedl C, Waltensdorfer A, Fruhwald S, Holl A, Purkart T, Wünsch G, Valentin T, Grisold A, et al: Vitamin D status and its association with season, hospital and sepsis mortality in critical illness. Crit Care. 18:R472014. View Article : Google Scholar : PubMed/NCBI

17 

Parekh D, Thickett DR and Turner AM: Vitamin D deficiency and acute lung injury. Inflamm Allergy Drug Targets. 12:253–261. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Hartmann B, Riedel R, Jörss K, Loddenkemper C, Steinmeyer A, Zügel U, Babina M, Radbruch A and Worm M: Vitamin D receptor activation improves allergen-triggered eczema in mice. J Invest Dermatol. 132:330–336. 2012. View Article : Google Scholar

19 

Yin Z, Pintea V, Lin Y, Hammock BD and Watsky MA: Vitamin D enhances corneal epithelial barrier function. Invest Ophthalmol Vis Sci. 52:7359–7364. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Kong J, Zhang Z, Musch MW, Ning G, Sun J, Hart J, Bissonnette M and Li YC: Novel role of the vitamin D receptor in maintaining the integrity of the intestinal mucosal barrier. Am J Physiol Gastrointest Liver Physiol. 294:G208–G216. 2008. View Article : Google Scholar

21 

You K, Xu X, Fu J, Xu S, Yue X, Yu Z and Xue X: Hyperoxia disrupts pulmonary epithelial barrier in newborn rats via the deterioration of occludin and ZO-1. Respir Res. 13:36–46. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Overgaard CE, Mitchell LA and Koval M: Roles for claudins in alveolar epithelial barrier function. Ann N Y Acad Sci. 1257:167–174. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Budinger GR and Sznajder JI: The alveolar-epithelial barrier: A target for potential therapy. Clin Chest Med. 27:655–669, abstract ix. 2006. View Article : Google Scholar : PubMed/NCBI

24 

Bhattacharya J and Matthay MA: Regulation and repair of the alveolar-capillary barrier in acute lung injury. Annu Rev Physiol. 75:593–615. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Li YC, Pirro AE, Amling M, Delling G, Baron R, Bronson R and Demay MB: Targeted ablation of the vitamin D receptor: An animal model of vitamin D-dependent rickets type II with alopecia. Proc Natl Acad Sci USA. 94:9831–9835. 1997. View Article : Google Scholar : PubMed/NCBI

26 

Golan MA, Liu W, Shi Y, Chen L, Wang J, Liu T and Li YC: Transgenic expression of vitamin D receptor in gut epithelial cells ameliorates spontaneous colitis caused by interleukin-10 deficiency. Dig Dis Sci. 60:1941–19477. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Matute-Bello G, Downey G, Moore BB, Groshong SD, Matthay MA, Slutsky AS and Kuebler WM: Acute Lung Injury in Animals Study Group: An official American Thoracic Society workshop report: Features and measurements of experimental acute lung injury in animals. Am J Respir Cell Mol Biol. 44:725–738. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Schneeberger EE and Lynch RD: The tight junction: a multifunctional complex. Am J Physiol Cell Physiol. 286:C1213–1228. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Migliori M, Giovannini L, Panichi V, Filippi C, Taccola D, Origlia N, Mannari C and Camussi G: Treatment with 1,25-dihy-droxyvitamin D3 preserves glomerular slit diaphragm-associated protein expression in experimental glomerulonephritis. Int J Immunopathol Pharmacol. 18:779–790. 2005.

30 

Takano Y, Mitsuhashi H and Ueno K: 1α,25-dihydroxyvitamin D3 inhibits neutrophil recruitment in hamster model of acute lung injury. Steroids. 76:1305–1309. 2011. View Article : Google Scholar : PubMed/NCBI

31 

Zhang M, Dong M, Liu W, Wang L, Luo Y, Li Z and Jin F: 1α,25-dihydroxyvitamin D3 ameliorates seawater aspiration-induced acute lung injury via NF-κB and RhoA/Rho kinase pathways. PLoS One. 9:e104507–e104516. 2014. View Article : Google Scholar

32 

Shih PK, Chen YC, Huang YC, Chang YT, Chen JX and Cheng CM: Pretreatment of vitamin D3 ameliorates lung and muscle injury induced by reperfusion of bilateral femoral vessels in a rat model. J Surg Res. 171:323–328. 2011. View Article : Google Scholar

Related Articles

Journal Cover

February-2016
Volume 13 Issue 2

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

The Cancer Story
Copy and paste a formatted citation
x
Spandidos Publications style
Shi YY, Liu TJ, Fu JH, Xu W, Wu LL, Hou AN and Xue XD: Vitamin D/VDR signaling attenuates lipopolysaccharide‑induced acute lung injury by maintaining the integrity of the pulmonary epithelial barrier. Mol Med Rep 13: 1186-1194, 2016
APA
Shi, Y., Liu, T., Fu, J., Xu, W., Wu, L., Hou, A., & Xue, X. (2016). Vitamin D/VDR signaling attenuates lipopolysaccharide‑induced acute lung injury by maintaining the integrity of the pulmonary epithelial barrier. Molecular Medicine Reports, 13, 1186-1194. https://doi.org/10.3892/mmr.2015.4685
MLA
Shi, Y., Liu, T., Fu, J., Xu, W., Wu, L., Hou, A., Xue, X."Vitamin D/VDR signaling attenuates lipopolysaccharide‑induced acute lung injury by maintaining the integrity of the pulmonary epithelial barrier". Molecular Medicine Reports 13.2 (2016): 1186-1194.
Chicago
Shi, Y., Liu, T., Fu, J., Xu, W., Wu, L., Hou, A., Xue, X."Vitamin D/VDR signaling attenuates lipopolysaccharide‑induced acute lung injury by maintaining the integrity of the pulmonary epithelial barrier". Molecular Medicine Reports 13, no. 2 (2016): 1186-1194. https://doi.org/10.3892/mmr.2015.4685