This article is mentioned in:

Introduction

Mesenchymal stem cells (MSCs) are viewed as a promising tool for cell-based therapies. Amniotic fluid is a source of mesenchymal stem cells that is of increasing interest. Human amniotic fluid (hAF) MSCs can be isolated from amniotic fluid from the second trimester of pregnancy by amniocentesis, a minimally invasive procedure. hAF-MSCs account for 0.9–1.5% of the cellular population in the amniotic fluid (1,2). As hAF-MSCs can give rise to osteogenic, chondrogenic, adipogenic, myogenic, endothelial, hepatic or neurogenic lineages (3) they have been shown to be effective in the treatment of many diseases (4). Due to the endothelial differentiation potential of MSCs, they have received a significant amount of attention as an autologous source for cell-based therapy in restoring endothelial functions and promoting vascularization (5,6).

In the cultivation process, the isolation and expansion protocols use FBS as a supplement as it has been used in several clinical trials (7). While FBS contains various growth factors, hormones and nutrients (8), it also possesses a high endotoxin content and can be a potential source of microbial contaminants, including fungi, bacteria, viruses and prions. Thus, clinical trials and future therapeutic applications of human MSCs should aim to avoid the use serums derived from animals (9). Studies have raised concerns about the possibility of animal pathogen transmission during the culture and transplantation processes (7,10). Additionally, it has been reported that patients who have received cell transplantations with MSCs expanded in FBS exhibit antibodies against bovine antigens (11). Therefore, a variety of human supplements have been selected as alternatives to the use of FBS to provide nutrients and growth factors (12).

Human platelet lysate (hPL) has been proposed as an alternative to animal serum for the expansion of MSCs in vitro (13). hPL contains various growth factors, including platelet-derived growth factor (PDGF), transforming growth factor (TGF) and epidermal growth factor (EGF) (11). These growth factors have been shown to enhance the proliferation rate of MSCs and maintain their multilineage differentiation potential under cultivation in the absence of FBS (9). Bioactive molecules and growth factors contained in hPL have been shown to support the expansion of MSCs derived from bone marrow (BM) (12), umbilical cord blood (14) and adipose tissue (10). Additionally, hPL has been reported to induce the endothelial differentiation of BM-MSCs (15).

Based on relevant data (9,10,12,14,15), the present study investigated the use of FBS or hPL as a supplement for cell culture and compared the characteristics of hAF-MSCs under these conditions. This present study focused on the endothelial differentiation potential of AF-MSCs when they were induced with vascular endothelial growth factor (VEGF) supplemented with either FBS or hPL.

Materials and methods

Preparation of human platelet lysate

Human donor platelets (n=15) were obtained from the blood bank of Maharaj Nakorn Chiang Mai Hospital using the platelet apheresis method after positive red blood cell antibody screening. Subsequently, hPL was prepared in accordance with a previously described method (8). Briefly, 15 pooled groups of platelets were frozen at −80°C and then thawed at 37°C; this was repeated three times. To remove membrane fragments, the lysate was centrifuged at 2,200 × g at room temperature for 20 min and the supernatant was filtered through a 0.2 µm filter (Corning Inc.). Aliquots of the platelet lysate were stored at −20°C. To avoid hPL gel formation, 2 U/ml heparin (LEO Pharma A/S) was added as an anticoagulant.

MTT cell viability assay

MTT (cat. no. 298-93-1; Sigma-Aldrich; Merck KGaA) was used to evaluate the optimal concentrations of hPL. hAF-MSCs were plated in a 96 well-plate at 5×103 cells in triplicate and incubated at 37°C with 5% CO2 and 95% humidity for 24 h. The cells were cultured with DMEM-high glucose (Gibco; Thermo Fisher Scientific, Inc.) supplemented with hPL (2.5, 5, 10, 20 or 40%) for 24, 48 or 72 h. As a control, cells were cultured with DMEM alone, containing neither FBS nor hPL. At the indicated time points, medium was removed and replaced with MTT solution (0.5 mg/ml in DMEM). After a further 4 h of incubation under the same conditions as for culture, MTT solution was removed and 100 µl DMSO was added to dissolve the formazan crystals. The absorbance was determined at 540 nm with a spectrophotometer.

Cell preparation and culture

Human amniotic fluid cell samples with a normal karyotype were obtained during weeks 16–22 of gestation from the Human Genetics Laboratory of the Anatomy Department, Faculty of Medicine, Chiang Mai University. This study was approved by the Research Ethics Committee of the Faculty of Medicine, Chiang Mai University on March 13th 2018 (no. ANA-2561-05343).

The cells collected were cultured with BIOAMF-3™ Complete Medium (Biological Industries) in a 25 cm2 culture flask (Corning Inc.) at 37°C, 5% CO2 and 95% humidity for 9 days at the Human Genetics Laboratory for routine prenatal diagnosis. After obtaining the cells, the medium was removed and the cells were washed with sterile PBS. They were then detached from the flask with 0.25% trypsin-EDTA (Gibco; Thermo Fisher Scientific, Inc.) and cultured in the basic growth medium: DMEM-high glucose with gentamycin, penicillin and streptomycin, and supplemented with FBS (cat. no. 16000036; Gibco; Thermo Fisher Scientific, Inc.) or hPL. The basic growth medium was supplemented with either 10% FBS, 10% hPL or 20% hPL. The cell density of each group was adjusted to 105 cells/cm2 in the culture flask. Cells were then incubated at 37°C, 5% CO2 and 95% humidity. The medium was changed every 3 days. Upon reaching 80% confluence, the passage 1 adherent cells were detached using 0.25% trypsin-EDTA. The determination of cell proliferation and characterization was performed after two passages.

Cell proliferation

hAF-MSCs were plated on a 24 well-plate (Corning Inc.) at a density of 104 cells/cm2. They were then cultured in basic media with either 10% FBS, 10% hPL or 20% hPL (10% FBS was used as the control in this experiment) at 37°C, 5% CO2 and 95% humidity. Cells were counted on day 0 and day 1, and then every second day until day 21 after seeding using a hemocytometer.

Flow cytometry

To characterize hAF-MSCs, the cell surface markers of cells cultured in basic media containing 10% FBS or 10% hPL were evaluated. The cells were trypsinized with 0.25% trypsin-EDTA at 37°C for 1 min and centrifuged at 2,035 × g for 6 min at room temperature to obtain the cell pellets. Then, non-specific binding was blocked using 10% human AB serum [serum from type AB donors; processed by our laboratory and inactivated at 53°C for 90 min as previously described (16)] at 4°C for 30 min. Subsequently, they were incubated with the following monoclonal antibodies: Mouse anti-human CD34-FITC (cat. no. 343504; BioLegend, Inc.), CD44-FITC (cat. no. 21810443; ImmunoTools GmbH), CD45-phycoerythrin (PE; cat. no. 304008; BioLegend, Inc.), CD73-PE (cat. no. 21270734; ImmunoTools GmbH), HLA-ABC-FITC (cat. no. 21159033; ImmunoTools GmbH) and HLA-DR-PE (cat. no. 21388994; ImmunoTools GmbH). Cell surface marker expression was detected using a FACScan (BD Biosciences) and analyzed using CellQuest™ Pro 9.0 software (BD Biosciences).

Differentiation of hAF-MSCs into endothelial cells

To investigate the endothelial differentiation potential of hAF-MSCs, the cells were plated in basic medium supplemented with 10% FBS or 10% hPL at a density of 104 cells/cm2 in a 24-well plate and induced with VEGF (cat. no. V7259; Sigma-Aldrich; Merck KGaA) for 14 days. They were then sub-cultured into two groups and cultured in basic media supplemented with either 10% FBS and 50 ng/ml VEGF or with 10% hPL and 50 ng/ml of VEGF (n=5).

Reverse transcription quantitative (RT-q)PCR

Total RNA of cells (FBS-supplemented non-induced cells, hPL-supplemented non-induced cells, FBS-supplemented induced cells and hPL-supplemented induced cells; n=5) was extracted using an Illutra RNAspin Mini RNA Isolation kit (GE Healthcare Life Sciences). First strand complementary DNA (cDNA) was then synthesized from total RNA using a Tetro cDNA synthesis kit (cat. no. BIO-65043; Bioline), according to the manufacturer's instructions. Briefly, the samples were incubated at 45°C for 30 min, followed by 85°C for 5 min to terminate the reaction. Gene transcripts were measured using a SensiFAST™ SYBR® No-ROX kit (cat. no. BIO-98005; Bioline) with a 7500 Fast Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). PCR primers targeting von Willebrand Factor (vWF), VEGF receptor 2 (VEGFR2), and endothelial nitric oxide synthase (eNOS) were used (Table I) (17). The protocol consisted of 36 cycles of 30 sec of denaturation at 95°C, 30 sec of annealing at 60°C and 60 sec of extension at 72°C. GAPDH was used as an internal control. The expression level of endothelial specific genes was plotted using the 2−ΔΔCq method (18).

Table I. Primer sequences of reverse transcription-quantitative PCR.

Table I.

Primer sequences of reverse transcription-quantitative PCR.

Primer	Sequence
vWF
Forward 5′-3′	CAAGGAAGAAAATAACACAGGTGAA
Reverse 5′-3′	TCATTGACCTTGCAGAAGTGAGTAT
VEGFR2
Forward 5′-3′	GACTTCCTGACCTTGGAGCATCT
Reverse 5′-3′	GATTTTAACCACGTTCTTCTCCGA
eNOS
Forward 5′-3′	TCCCCCAGAACTCTTCCTT
Reverse 5′-3′	CTCATTCTCCAGGTGCTTCA
GAPDH
Forward 5′-3′	ATGGGGAAGGTGAAGGTCG
Reverse 5′-3′	TAAAAGCAGCCCTGGTGACC

[i] vWF, von Willebrand factor; VEGFR2, vascular endothelial growth factor receptor 2; eNOS endothelial nitric oxide synthase.

Immunofluorescence

Cells from all conditions (non-induced and induced cells with FBS or hPL supplement; n=5) were analyzed for the expression of endothelial specific markers (vWF VEGFR2, and eNOS). In brief, the cells were washed twice with PBS and fixed with 4% paraformaldehyde at room temperature for 15 min. They were then permeabilized with 0.2% Triton X-100 (Amresco, LLC) in PBS at room temperature for 10 min. Then, blocking for non-specific binding was conducted with 10% human AB serum in 1% BSA-PBS for 30 min at room temperature, followed by incubation with mouse monoclonal antibody against human vWF (cat. no. MA5-14029; Pierce; Thermo Fisher Scientific, Inc.), rabbit monoclonal antibody against human VEGFR2 (cat. no. MA5-16417; Pierce; Thermo Fisher Scientific, Inc.) or mouse monoclonal antibody against eNOS (cat. no. MA5-15559; Pierce; Thermo Fisher Scientific, Inc.) at 37°C for 2 h at a dilution of 1:200. After washing the cells twice with PBS, FITC-conjugated goat anti-mouse IgG antibody (cat. no. 62-6511; Thermo Fisher Scientific, Inc.) or PE-conjugated goat anti-rabbit IgG antibody (cat. no. P-2771MP; Thermo Fisher Scientific, Inc.) were added and incubated at 37°C for 1 h at a dilution of 1:500. For nuclear staining, the cells were incubated with antifade DAPI (2 µl) for 10 min at room temperature (Invitrogen; Thermo Fisher Scientific, Inc.). Samples were examined using an Olympus AX70 fluorescent microscope and images were captured with DP manager and DP controller (magnification, ×20; Olympus Corporation). Statistical analysis of fluorescent signals was conducted using ImageJ 1.50i software (National Institutes of Health).

Network formation

Network formation potential was assessed by incubating the cells from all conditions (non-induced and induced cells with FBS or hPL supplement; n=5) in Matrigel growth factor-reduced basement membrane matrix (Corning Inc.), according to the manufacturer's instructions. Briefly, Matrigel was thawed at 4°C overnight and added to a 96 well-plate at a concentration of 50 µl/cm2 with pre-cooled pipette tips. Next, the plate was incubated at 37°C for 30 min. After cell preparation, cells were counted and the concentration was adjusted to 2×105 cells/100 µl. Cells were then added at the selected density to the gel-coated wells and were incubated at 37°C, 5% CO2 and 95% humidity for 24 h. A human umbilical vein endothelial cell (HUVEC) line (Gibco; Thermo Fisher Scientific, Inc.) was used as a positive control. Network formation was observed under a light microscope (magnification, ×20). ImageJ angiogenesis analyzer (http://image.bio.methods.free.fr/ImageJ/?Angiogenesis-Analyzer-for-ImageJ) was used to analyze the total mesh area and the mesh number.

Statistical analysis

Data were presented as the mean ± standard error of the mean (n=5 for all experiments). Statistical comparisons were performed three times using a Kruskal-Wallis test with a post hoc Dunn's test or a Mann-Whitney U test. Statistical analysis was performed using SPSS version 22.0 software (IBM Corp). P<0.05 was considered to indicate a statistically significant difference.

Results

Analysis of cell viability using the MTT assay

hAF-MSCs were cultured in basic media supplemented with hPL at 2.5, 5, 10, 20 or 40% for 24, 48 and 72 h. The results indicated an increase in cell viability compared to the control at all time points. Cell viability at 72 h was significantly increased compared with at 24 and 48 h under all experimental conditions, with the exception of control treatment (P<0.05; Fig. 1).

Figure 1. Determination of hAF-MSC cell viability following culture in hPL using the MTT assay. Viability of hAF-MSCs cultured in media supplemented with various concentrations of hPL for 24, 48 and 72 h. The cells cultured in media with no supplementation were used as the control. The percentage of viable cells is presented as the mean ± SEM. The Kruskal-Wallis test with post hoc Dunn's test analysis were used to analyze the results of this experiment (*P<0.05). hAF-MSCs, human amniotic fluid mesenchymal stem cells; hPL, human platelet lysate.

Morphology of hAF-MSCs

Microscopic examination revealed that at passage 2 the hAF-MSCs cultured in basic media supplemented with 10% FBS, 10% hPL or 20% hPL densely adhered to the flask in a monolayer and displayed a homogeneous fibroblast-like morphology (Fig. 2).

Figure 2. Morphology of the hAF-MSCs cultured in media supplemented with FBS or hPL. hAF-MSCs cultured in 10% FBS-supplemented medium, 10% hPL-supplemented medium or 20% hPL-supplemented medium (magnification, ×20; scale bar, 100 µm). hAF-MSCs, human amniotic fluid mesenchymal stem cells; hPL, human platelet lysate.

Proliferation of hAF-MSCs

The growth curve demonstrated that cell number in each condition (Fig. 3) increased continuously in the log phase with no significant difference between conditions. The 10% FBS- and 10% hPL-supplemented cells entered into the stationary phase with no significant differences in cell number. However, cells supplemented with 20% hPL showed a decrease in cell number between days 11 and 15. A lower cell number was maintained between days 13 and 21.

Figure 3. Proliferation of hAF-MSCs cultured in media supplemented with FBS or hPL. Number of hAF-MSCs cultured in media supplemented with either 10% FBS, 10% hPL or 20% hPL. Data are presented as the mean ± SEM. The Kruskal-Wallis test and a post hoc analysis were used to analyze the results of this experiment. hAF-MSCs, human amniotic fluid mesenchymal stem cells; hPL, human platelet lysate.

Analysis of the expression of cell surface markers by flow cytometry

Flow cytometry was used to characterize the expression of cell surface markers in the hAF-MSCs. The results showed that the expression of cell surface markers did not differ between the cells cultured in 10% FBS-supplemented media and 10% hPL-supplemented media. The hAF-MSCs from these two groups were positive for CD44, CD73 and HLA-ABC, cell surface markers that are expressed by hAF-MSCs and negative for CD34, CD45 and HLA-DR (Fig. 4).

Figure 4. Analysis of cell surface marker expression in hAF-MSCs cultured in media supplemented with FBS or hPL. Flow cytometry histograms of 10% FBS-supplemented (green) or 10% hPL-supplemented (red) hAF-MSCs with isotype control (black: FBS-supplemented cells; gray: hPL-supplemented cells). The expression of the cell surface markers CD34, CD44, CD45, CD73, HLA-ABC and HLA-DR were analyzed. hAF-MSCs, human amniotic fluid mesenchymal stem cells; hPL, human platelet lysate.

Morphology of induced hAF-MSCs

hAF-MSCs were induced and divided into two groups (basic media supplemented with 10% FBS and 50 ng/ml VEGF or basic media supplemented with 10% hPL and 50 ng/ml VEGF). After 14 days of VEGF exposure in media supplemented with either 10% FBS or 10% hPL, both sets of cells exhibited a spindle shape. However, oval and round spaces appeared within the surrounding adhered cells in the hAF-MSCs cultured with the hPL-supplemented media (Fig. 5).

Figure 5. Morphology of hAF-MSCs cultured in media supplemented with FBS or hPL. The morphology of 10% FBS-supplemented or 10% hPL-supplemented hAF-MSCs induced with vascular endothelial growth factor for 14 days (left: Magnification, ×10, scale bar, 100 µm; right: Magnification, ×40). hAF-MSCs, human amniotic fluid mesenchymal stem cells; hPL, human platelet lysate.

Detection of endothelium-related gene expression

After 14 days of induction with VEGF, the expression of endothelium-related genes, including vWF, VEGFR2 and eNOS, was determined using RT-qPCR (Fig. 6). The results revealed that the expression levels of vWF (Fig. 6A), VEGFR2 (Fig. 6B) and eNOS (Fig. 6C) were increased in FBS-supplemented induced cells when compared to non-induced control cells cultured in FBS supplemented media (2.66-fold, 2.10-fold and 1.73-fold, respectively). Similarly, the levels of these genes were increased in the hPL-supplemented induced cells when compared to non-induced control cells cultured in hPL supplemented media (3.93-fold, 2.94-fold and 2.30-fold, respectively). Furthermore, the expression levels of vWF, VEGFR2 and eNOS were increased to a greater extent in the induced cells that were cultured with 10% hPL compared to the cells that had been cultured with 10% FBS.

Figure 6. Detection of endothelial-related gene expression in non-induced and induced human amniotic fluid mesenchymal stem cells by real time quantitative PCR. FBS-supplemented non-induced cells, hPL-supplemented non-induced cells, FBS-supplemented induced cells and hPL-supplemented induced cells were analyzed to determine endothelial-related gene expression levels. The relative expressions of (A) vWF, (B) VEGFR2 and (C) eNOS was determined. Gene expression levels were normalized to GAPDH and were relative to the control. The Mann-Whitney U Test was performed to analyze the results of this experiment *P<0.05. hPL, human platelet lysate; vWF, von Willebrand factor; VEGFR2, vascular endothelial growth factor receptor 2; eNOS endothelial nitric oxide synthase.

Expression of endothelial specific markers

The expression of vWF, VEGFR2 and eNOS was analyzed under both induced and non-induced conditions. The results of immunofluorescence analysis revealed that the induced cells cultured with either FBS or hPL expressed vWF, VEGFR2 and eNOS. Conversely, no signal was detected for these proteins in non-induced conditions when cultured in media supplemented with either FBS or hPL (Fig. 7A). Analysis using ImageJ 1.50i software was used to calculate the corrected total cell fluorescence (CTCF). The data showed that there were significant differences in CTCF levels for vWF (Fig. 7B), VEGFR2 (Fig. 7C) and eNOS (Fig. 7D) between the non-induced and induced cells when cultured with either FBS or hPL. CTCF analysis revealed no marked differences between induced cells cultured in FBS-supplemented or hPL-supplemented media (Fig. 7B-D).

Figure 7. Detection of the expression of endothelial-specific markers using immunofluorescence. FBS-supplemented non-induced cells, hPL-supplemented non-induced cells, FBS-supplemented induced cells and hPL-supplemented induced cells were stained with antibodies against vWF, VEGFR2 or eNOS. Cell nuclei were stained with DAPI (magnification, ×20; scale bar, 100 µm). (A) Representative images of cells stained for vWF, VEGFR2 and eNOS. Quantification of fluorescent signals using corrected total cell fluorescence of (B) vWF, (C) VEGFR2 and (D) eNOS. The Mann-Whitney U test was used to analyze the results of this experiment *P<0.05. hPL, human platelet lysate; vWF, von Willebrand factor; VEGFR2, vascular endothelial growth factor receptor 2; eNOS endothelial nitric oxide synthase.

Ability to form networks

The formation of networks was observed using a light microscope after incubating the cells in Matrigel-coated plates for 24 h. The non-induced cells from both the FBS and hPL conditions did not present a network-like structure, while the FBS-supplemented induced cells exhibited some connection to the cell processes. Interestingly, the hPL-supplemented induced cells displayed a network formation that was similar to HUVECs (Fig. 8A). The quantitative data were analyzed by angiogenesis analyzer, ImageJ 1.50i software. The data are presented in terms of the total mesh area (Fig. 8B) and mesh number (Fig. 8C) in FBS-supplemented induced cells, hPL-supplemented induced cells and HUVECs. The Kruskal-Wallis test and post hoc analysis demonstrated that the quantification of the two parameters between three groups was found to be significant.

Figure 8. Ability of FBS-supplemented non-induced cells, FBS-supplemented induced cells, hPL-supplemented non-induced cell, hPL-supplemented induced cells and HUVECs to form a network-like structure. (A) Comparison of (B) total mesh area and (C) mesh number between FBS-supplemented induced cells, hPL-supplemented induced cells and HUVECs (magnification, ×20; scale bar, 100 µm). The Kruskal-Wallis test and post hoc analysis were used to analyze the results of this experiment *P<0.05. hPL, human platelet lysate; HUVECs, human umbilical vein endothelial cell.

Discussion

MSCs have been used in cell-based therapies to treat or restore damaged tissue (4). Amniotic fluid is a source of MSCs in which the cells can be isolated and expanded easily (19). Although FBS is widely used to culture MSCs, this culturing method raises concerns about the potential for xenogeneic protein transmission from the animal-derived sera (13). This present study investigated pooled hPL as a replacement for FBS in the culture media of hAF-MSCs, with a focus on the potential of hAF-MSCs to undergo endothelial differentiation. The hPL was obtained from platelet concentrate via a standardized platelet apheresis technique, providing a high concentration of platelets and a low level of leukocyte contamination (20). The optimal concentration of hPL was evaluated using the MTT assay. The results revealed significant differences after hAF-MSCs were cultured in hPL-supplemented media for 72 h; however, there was no significant difference in terms of cell viability at each concentration. Based on this data, 10 and 20% hPL were selected in order to investigate the mesenchymal characteristics of hAF-MSCs.

The culture of hAF-MSCs with media supplemented with 10% FBS, 10% hPL or 20% hPL revealed a fibroblast-like morphology, consistent with previous studies (10,11,21). This present study found that the culturing of hAF-MSCs for 21 days in 10% FBS- or 10% hPL-supplemented media revealed no significant differences in terms of proliferation capacity. However, proliferation capacity decreased in cells cultured with 20% hPL; this result was not consistent with a previous study (22). This may suggest variations in the components of hPL between batches. Studies have revealed that there are many growth factors contained in hPL that promote MSC proliferation and differentiation, including basic fibroblast growth factor (bFGF), EGF, insulin-like growth factor 1 (IGF-1), PDGF, VEGF and TGF-β (7,9,23). As has been reported previous studies, hPL is often used at a concentration of 10% (9,24,25). Consequently, this concentration was selected to evaluate MSC characteristics. The results of the flow cytometry experiments indicated that hAF-MSCs cultured with 10% FBS or 10% hPL had a similar level of expression of cell surface markers. The data presented here indicate that supplementation of media with hPL can maintain the growth characteristics and the phenotypic profile of hAF-MSCs (26). Therefore, there is the possibility that hPL can be used instead of FBS in pre-clinical applications.

According to the properties of MSCs, they are able to differentiate according to their mesodermal lineage. Previous studies have shown the potential of hAF-MSCs to be differentiated into osteocytes and chondrocytes (27,28). In this present study, hAF-MSCs that were induced using VEGF when cultured with hPL-supplemented media were capable of endothelial differentiation. Following 14 days of stimulation by VEGF, the hAF-MSCs displayed endothelial-like characteristics. The induced cells cultured in media supplemented with FBS were densely adhered with a fibroblast-like morphology. By contrast, the cells cultured in media supplemented with hPL displayed different arrangements, consistent with another study (29). Gene expression analysis using RT-qPCR also demonstrated that vWF, VEGFR2 and eNOS were expressed in induced cells cultured in media supplemented with either FBS or hPL at higher levels than in the non-induced cells. Furthermore, the data indicated that the cells cultured with hPL and induced with VEGF showed a higher level of expression than induced cells cultured with FBS. These results were investigated further using immunofluorescence analysis. This analysis indicated that there were specific proteins expressed in induced cells cultured with FBS or hPL. These results were consistent with a previous study that reported that hPL can induce expression of endothelial markers (15). Platelet lysate has been identified as a potent induction factor because it contains various growth factors that have an effect on endothelial cell maturation and growth (15). It has been reported that VEGF and angiopoietin-1 in hPL stimulate the AKT pathway to promote cell survival and vascular development in cardiovascular function (30). Studies have also indicated that supplementation of media with IGF-1, EGF and bFGF can enhance the endothelial differentiation potential of induced cells (31–33).

This present study also indicates that induced hAF-MSCs have the potential to form networks on Matrigel. hPL-supplemented induced cells formed network-likes structure that were comparable with those formed by HUVECs. This suggested that growth factors released by platelets could promote angiogenesis in vitro. Studies have demonstrated that hPL induces vasculogenic and angiogenic responses in endothelial colony forming cells mediated by growth factors, including VEGF, bFGF and PDGF, leading to the formation of capillary network (30,34). Angiogenic effects can be activated via the ERK1/2 pathway and the angiopoietin-1/Tie2 pathway in response to the level of VEGF (35). Moreover, the effect of hPL treatment on endothelial cells can stimulate the ERK1/2 pathway to enhance wound healing, cell proliferation and vessel growth (36). The data in the present study indicate that hPL has a role in the differentiation of hAF-MSCs, as they exhibited some endothelial specific markers (vWF, VEGFR2 and eNOS) and formed capillary-like structures. Therefore, the use of pooled hPL may be applied in xenogenic-free approaches and strategies to improve vascularization.

A limitation of the present study is the requirement for more information about the concentration of growth factors in hPL. The identification and quantification of the various growth factors in hPL using ELISA is necessary. The effect of other growth factors that may synergize with VEGF should also be considered. In addition, a larger expression profile should be carried out. It is also important to identify the factors, and their concentrations, present in FBS and hPL. Finally, it is also important to elucidate the role of specific growth factors in the endothelial differentiation pathway.

In conclusion, the present study has demonstrated that hAF-MSCs can be cultured in hPL-supplemented media while maintaining the proliferation and immune phenotype, as well as increasing the endothelial differentiation potential. This suggests that hPL may be used as an alternative to FBS. hPL is also associated with a high degree of safety when used in clinical grade-cell expansion and the treatment of vascular disease.

Acknowledgements

All human amniotic fluid cells were provided by the Human Genetic Laboratory, Department of Anatomy and the Thailand Excellence Center for Tissue Engineering and Stem Cells, Department of Biochemistry, Faculty of Medicine, Chiang Mai University. The authors would like to thank the blood bank of Maharaj Nakorn Chiang Mai Hospital for supplying the platelet concentrates.

Funding

This study was funded by the Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand (grant no. ANA-2561-05343).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

WT and SA conceived the experiments, and PP designed the experiments. KB, CP and NP made substantial contributions to the design of the study. SN analyzed and interpreted the data. RM and TL collected and analyzed the data. CT performed the experiments. The paper was drafted by WT and the manuscript was approved by all authors.

Ethics approval and consent to participate

Written informed consent was obtained and the protocol employed was approved by the Ethics Committee of the Faculty of Medicine, Chiang Mai University on March 13th 2018 (no. ANA-2561-05343).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References