Open Access

Effects of GPR81 silencing combined with cisplatin stimulation on biological function in hypopharyngeal squamous cell carcinoma

  • Authors:
    • Qiaojing Jia
    • Ou Xu
    • Jianxing Wang
    • Jinhui Dong
    • Xiumin Ren
    • Xiaofang Jia
    • Chunguang Shan
  • View Affiliations

  • Published online on: June 18, 2020     https://doi.org/10.3892/mmr.2020.11255
  • Pages: 1727-1736
  • Copyright: © Jia et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Hypopharyngeal squamous cell carcinoma (HSCC) is a malignant tumor found in the head and neck region. Lactate receptor 1, also known as G protein‑coupled receptor81 (GPR81), has been reported to play a vital role in cancer growth and metabolism. However, the function of GPR81 in HSCC remains largely unknown. The present study investigated the effect of GPR81 on cell survival and GPR81‑mediated energy metabolism under cisplatin treatment in HSCC. GPR81 knockdown reduced the proliferation and invasion of the human HSCC cell line FaDu. Furthermore, GPR81 silencing combined with cisplatin treatment increased the expression of translocase of outer mitochondrial membrane 20 at the mRNA and protein levels (P<0.05). mRNA and protein expression of phosphofructokinase 1 in mRNA appeared to be downregulated in GPR81 knockdown FaDu cells treated with cisplatin, although this was not statistically significant. GPR81 silencing and cisplatin challenge showed no significant upregulation compared with the control, but significant downregulation in mRNA and protein levels compared with the shRNA‑scramble group. Apoptosis was measured by flow cytometry with annexin V and 7‑aminoactinomycin D. GPR81 silencing and cisplatin led to an increased apoptotic rate. Moreover, absence of GPR81 combined with cisplatin exposure increased caspase‑3 expression and decreased Bcl‑2 levels. The results of the present study suggested that GPR81 and cisplatin sensitivity played an important role in HSCC growth and metabolism.

Introduction

Head and neck cancer is historically common and lethal in adults worldwide (1). As a frequently occurring malignancy, hypopharyngeal squamous cell carcinoma (HSCC) is a major focus of research due to its high morbidity and mortality rates. The incidence of HSCC, regardless of age and sex, has increased, particularly in the developing world (2). Risk factors for HSCC include alcohol use, tobacco exposure, betel quid chewing, HPV infection and personal history, such as genetics, toxin exposure, diet and environmental factors (3,4). Due to advances in diagnostic and therapeutic modalities, the survival rate for hypopharyngeal cancer has improved since 1990 (5). However, ~3,000 new cases are diagnosed annually in the USA (6). Thus, a better understanding of the molecular mechanisms underlying HSCC progression will likely provide insight regarding the treatment of HSCC on an individual basis.

Tumors have large bio-energetic requirements for the maintenance of cell growth and proliferation. The hypoxic and glucose-poor tumor micro-environment requires tumor cells to alter their metabolic patterns to adapt to these conditions (7). A high rate of glycolysis, with production of lactate and decreasing mitochondrial oxidative phosphorylation (OXPHOS) metabolism is a universal phenomenon in carcinoma cells (8,9), which results in the accumulation of lactate within cells. Lactate in the tumor micro-environment is catalyzed by lactate dehydrogenase to synthesize pyruvate, and provide metabolic fuel for OXPHOS.

Lactate also takes part in the production of ATP, as part of the tricarboxylic acid cycle (10,11), and can also be used as a substrate for gluconeogenesis (12). In the process of energy metabolism, the accumulation of lactate tends to rely on the cell membrane receptor G-protein coupled receptor 81 (GPR81) and monocarboxylase transporters (MCTs). GPR81 is mainly expressed in adipocytes, skeletal muscle and brain, and is involved in energy metabolism (1315). Previously, GPR81 was observed to be important in various types of cancer, participating in cell survival, metastasis, tumor growth and chemoresistance (1618). GPR81 is activated by lactate, which inhibits the conversion of ATP to cAMP (19). MCT1 has a high affinity binding ability for lactate and is mainly responsible for lactate uptake (20,21). Roland et al (18) demonstrated that GPR81 is important for cancer cell regulation of lactate transport mechanisms, and alters the expression of MCT1 and MCT4 in the presence of lactate and glucose.

Phosphofructokinase 1 (PFK-1) is a primary control enzyme in the glycolytic pathway, which catalyzes the phosphorylation of fructose 6-phosphate to fructose 1,6-bisphosphate, accompanied by ATP conversion to ADP. In tumors, PFK-1 levels are increased compared with non-tumor cells (18,22), suggesting that PFK-1 might be a functional biomarker of abnormal energy metabolism. As a key rate-limiting enzyme, the modification and alteration of PFK-1 in glycolysis can disturb the glycolytic pathway and result in metabolic disorders.

Tumor cells consume glucose through anaerobic glycolysis and generate lactate and ATP even in the presence of oxygen, which is known as the Warburg effect (23). Glycolysis and OXPHOS co-exist in cancer cells and facilitate tumorigenesis and metastasis (24).

Translocase of the outer mitochondrial membrane 20 (TOMM20) is a key subunit of the TOM complex and a vital mitochondrial transport protein. TOMM20 is regarded as a positive marker of OXPHOS (25) and is associated with many malignant tumors (25,26).

Lactate, which is mainly generated by glycolysis in tumors, was recently identified as a major fuel for OXPHOS and an activator of energy conversion signaling pathways (27). To the best of the authors' knowledge, only a few previous publications have studied the effect of GPR81 silencing and cisplatin treatment on cell survival and energy metabolism in HSCC. Therefore, in the present study, several factors associated with glycolysis and OSPHOS were analyzed. The molecular role of GPR81 in the HSCC cell line FaDu was investigated. Furthermore, the influence of silencing GPR81 combined with cisplatin on the expression of PFK-1 and TOMM20 was studied, in order to identify the role played by GPR81 in glycolysis and OXPHOS, in the context of HSCC. The effect of GPR81 knockdown combined with cisplatin treatment on cell survival was also examined.

Materials and methods

Cell lines and cell culture

The human FaDu cell line is derived from hypopharyngeal carcinoma. FaDu cells obtained from China Center For Type Culture Collection were cultured in RPMI-1640 (Gibco, Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Hyclone; GE Healthcare Life Sciences), 100 U/ml penicillin, 100 mg/ml streptomycin and 0.1 M HEPES in a humidified atmosphere containing 5% CO2 at 37°C.

Plasmid construction

The interference plasmids containing human short hairpin shRNA (shRNA)-GPR81 (also known as hHCAR1) and shRNA-scramble were obtained from Cyagen Biosciences, Inc. The shRNA-GPR81 plasmid effectively inhibited the expression of GPR81, and the shRNA-scramble plasmid acted as a control.

GPR81 knockdown and cell challenge

In order to inhibit the expression of GPR81, FaDu cells were transfected with 2.5 µg shRNA-GPR81 plasmid and 2.5 µg shRNA-scramble plasmid was used as a control. Transfections were carried out using Lipofectamine® 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Transfection efficiency was determined in the experimental group and the control group by western blot analysis. Following transfection for 48 h, the transfected cells were then challenged for 24 h with cisplatin at concentrations of 0, 0.5, 1, 2 and 5 µg/ml. Each group was plated in triplicate. Cells were collected for RNA and protein extraction.

Cell proliferation assay

Following transfection with shRNA-GPR81 and shRNA-scramble plasmid for 48 h, cells were seeded into a 96-well plate at a density of 5×103 cells/well and stimulated with 5 µg/ml cisplatin. Cell proliferation was evaluated using Cell Counting Kit-8 reagent (CCK-8; Beyotime Institute of Biotechnology) according to the manufacturer's protocol. The proliferation of FaDu cells was measured by the absorbance at a wavelength of 450 nm (OD450; where OD indicates optical density).

Transwell Matrigel™ invasion assay

The invasive capacity of FaDu cells transfected with shRNA-GPR81 was assessed with Transwell Matrigel invasion assays. A 24-well chamber covering Matrigel™-coated (diluted 1:3 in serum-free medium on ice; 100 µl/cm2) membranes with a pore size of 8 µm (Corning, Inc.) was used to assess cell invasion. Transfected cells were diluted in serum-free medium to a concentration of 1×105 cells/ml. Cell suspensions (100 µl) were added to the upper chamber, and the lower chamber was injected with 500 µl cell culture medium containing 20% FBS. Cells were incubated for 24 h at 37°C with 5% CO2.

The upper chamber was washed with PBS twice and cells under the chamber membrane were fixed with 4% paraformaldehyde for 5–10 min at 4°C, then stained with 1% crystal violet for 10 min at room temperature. The stained cells were washed with PBS twice to wipe the staining fluid off of the membrane. Cells were passed through the filter, and cotton tips were used to remove cells remaining on the upper membrane. The invasion of cells was evaluated with an inverted fluorescent microscope (magnification, ×200, Olympus). Each group was set triplicate wells.

Semi-quantitative-PCR

Total RNA derived from challenged FaDu cell lines was isolated using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The quality of total RNA was detected by electrophoresis on a 1.2% agarose gel. The concentration of RNA was measured using a NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific, Inc.). First strand cDNA was synthesized from total RNA using Fast Reverse Transcriptase (Tiangen Biotech Co., Ltd.), following the manufacturer's instructions. Semi-quantitative PCR was used to detect mRNA expression levels of related genes. The PCR product was visualized by agarose gel containing 0.5 mg/ml ethidium bromide (EB). And the grey scale value of PCR band was analyzed with ImageJ software v1.8.0 (National Institutes of Health). The primers were designed to amplify specific fragments. The primer sequences of detected genes are presented in Table I.

Table I.

Primer sequences.

Table I.

Primer sequences.

NameSequence, 5′-3′Length, nucleotidesTm, °C
GPR81-F1 TGGCTGCGGACAGGTATT1858.8
GPR81-R1 CCAAACAATCTTGAAGGAGC2057.8
TOMM20-F1 GACCGCAAAAGACGAAGTG1957.3
TOMM20-R1 GGAACACTGGTGGTGGAAG1958.2
PFK-1-F1 TCAGAAGAGGGCAAAGGC1858.6
PFK-1-R1 GCTTGAGCCACCACTGTTCT1958.4
MCT1-F1 TCAAAATAGTCCGATGCC1851.0
MCT1-R1 TGCTGTTTTCCTTCTGCC1853.9
Caspase-3-F1 GAATGACATCTCGGTCTGGT2054.1
Caspase-3-R1 TGTCTCAATGCCACAGTCC1953.8
Bcl-2-F2 TCCAGGATAACGGAGGCT1854.9
Bcl-2-R2 CACTTGTGGCTCAGATAGGC2055.5
β-actin-F1 TTGGCAATGAGCGGTTCC1858.3
β-actin-R1 GAAGGTGGACAGCGAGGC1957.2

[i] Tm, melting temperature; F, forward; R, reverse; GPR81, G protein-coupled receptor 81; PFK-1, phosphofructokinase; TOMM20, translocase of outer mitochondrial membrane 20; MCT1, monocarboxylase transporter 1.

The amplification was performed in a total volume of 20 µl, containing 10 µl 2X Taq PCR Master Mix (Tiangen Biotech Co., Ltd.), 1 µl diluted cDNA (1 µg/µl), 0.5 µl each primer (10 µM) and 8 µl nuclease-free water. Thermocycling conditions for GPR81, TOMM20, PFK-1 and actin genes were as follows: 94°C for 3 min as initial denaturation, 35 cycles of 94°C for 30 sec, 56°C for 30 sec, 72°C for 40 sec, then 72°C extension for 10 min. For caspase-3 and Bcl-2, the same thermocycling conditions were used, except for annealing, which was carried out at 53°C for 30 sec. The annealing temperature of MCT1 was 51°C, and the other steps were identical to other genes. All PCR products were held at 16°C at the final stage of PCR before detection on an agarose gel.

Western blotting

Cells were lysed with cold RIPA protein lysis buffer supplemented with protease inhibitor (Beijing Solarbio Science & Technology Co., Ltd.), then placed on a horizontal shaking table for 40 min at 4°C. Split samples were centrifuged at 12,000 × g for 20 min at 4°C. The supernatant was collected to determine protein density using a BCA Protein Assay kit (Beijing Solarbio Science & Technology Co., Ltd.). The isolated protein was added to 6X SDS-PAGE loading buffer and boiled for 10 min at 99°C. The denatured protein (~40 µg) was first separated by SDS-PAGE on pre-cast polyacrylamide gels (12% separating gel; 5% stacking gel), then transferred to a wet polyvinylidene fluoride membrane. The transferred membrane was dipped in 5% bovine serum albumin at 37°C for 1 h, then incubated with primary antibodies (GPR81, Abcam, cat. no. ab106942, 1:1,000; PFK-1, Santa Cruz Biotechnology, Inc., cat. no. sc-166722, 1:1,000; TOMM20, Abcam, cat. no. ab186734, 1:1,000; ß-actin, Santa Cruz Biotechnology, Inc., cat. no. sc-47778, 1:2,000) at 4°C overnight. Antibody dilutions were made according to the manufacturer's protocol. The membrane was washed with TBS with Tween-20 for 5 min three times. The membrane was then incubated with HRP-conjugated goat anti-rabbit IgG antibody (Abcam, cat. no. ab181662, 1:2,000) at room temperature for 2 h. The blots were visualized using an enhanced chemiluminescence detection kit (Thermo Fisher Scientific, Inc.). Grayscale blots were analyzed with ImageJ v1.8.0 (National Institutes of Health).

Apoptosis detection

FaDu cells (~1×105-per well) were seeded in 6-well plates were transfected with shRNA-GPR81 and shRNA-scramble plasmids. Then, the transfected cells were challenged for 24 h with cisplatin at the concentration of 5 µg/ml. Cells were digested with 0.25% EDTA-trypsin and washed twice with cold PBS. Apoptosis was assessed in each group according to the annexin V-allophycocyanin/7-aminoatinomycin D apoptosis kit protocol (MultiSciences Biotech Co,. Ltd.). The apoptotic cell rate was calculated by the sum of Q2 (apoptosis at late phase or necrotic cells) and Q3 (apoptosis at early stage).

Statistical analysis

SPSS 21.0 statistical software (IBM Corp.) was used to analyze the data, using one-way ANOVA followed by Tukey's multiple comparison test. The differences between two groups were analyzed by Student's t-test. All data are presented as the mean ± SD. P-values were two-sided and P<0.05 was considered to indicate a statistically significant difference.

Results

Effect of GPR81 on cell proliferation and invasion

The efficiency of GPR81 gene deletion was detected by semi-quantitative PCR and western blotting in FaDu cells transfected with shRNA-GPR81 and shRNA-scramble plasmid vector (Fig. 1). To examine the effect of GPR81 on cell proliferation and invasion, a CCK-8 assay and a Transwell Matrigel™ assay were performed, respectively.

For the CCK-8 assay, the mean OD450 value in the control, shRNA-scramble and shRNA-GPR81 groups increased to different extents, suggesting a difference in proliferative capacity between theshRNA-GPR81, shRNA-scramble and untreated cell groups. The mean values of OD450 in the control group were 0.386±0.017, 0.788±0.013, 1.045±0.053 and 1.354±0.035 at time points 0, 24, 48 and 72 h, respectively. The mean values of OD450 in the shRNA-scramble group were 0.38±0.012, 0.689±0.065, 0.932±0.051 and 1.194±0.08 at 0, 24, 48 and 72 h, respectively. This was not statistically significant, compared with the control group (P>0.05). The mean OD450 values in the shRNA-GPR81 group at 0, 24, 48 and 72 h, were 0.367±0.01, 0.451±0.02, 0.634±0.046 and 0.838±0.066, respectively. At the time points of 48 and 72 h, the OD450 values in shRNA-GPR81 group were significantly lower compared with the control group and shRNA-scramble group (with *P<0.05 vs. control and #P<0.05 vs. shRNA-scramble), indicating that silencing GPR81 could inhibit the proliferation of FaDu cells (Fig. 2A). These results suggested that GPR81 affected cell proliferation.

In the Transwell Matrigel™ assay, the mean number of cells passing through the membrane in the control, shRNA-scramble and shRNA-GPR81 groups were 1.726±0.098×104, 1.5677±0.082×104 and 0.514±0.102×104, respectively. The invading cells in the GPR81 silencing group was significantly lower than the shRNA-scramble group (with *P<0.05 vs. control and #P<0.05 vs. shRNA-scramble; Fig. 2B). These results indicated that silencing GPR81 in FaDu cells inhibited cell invasion.

GPR81 combined with cisplatin affects the expression of genes involved in glycolysis and OXPHOS

RT-semi quantitative PCR and western blotting were used to detect the expression of PFK-1, TOMM20 and MCT1 in FaDu cells at the nucleic acid and protein levels. The influence of cisplatin challenge on PFK-1, TOMM20 and MCT-1 is shown in Fig. S1.

The mRNA expression of PFK-1 in GPR81 knockdown cells combined with cisplatin stimulation slightly decreased, but there was no significant difference compared with untreated cells (P>0.05). PFK-1 in cells transfected with shRNA-scramble significantly increased rapidly at higher concentrations of cisplatin, which were significantly higher than shRNA-GPR81 cells (P<0.05). At 2 and 5 µg/ml cisplatin, the difference between two groups was statistically significant (P<0.05). These results indicated that GPR81 combined with cisplatin might have some influence on the expression of PFK-1 compared with shRNA-scramble group, but no significant effect vs. untransfected cells (Fig. 3A and D).

For the TOMM20 gene, the mRNA expression increased significantly after challenge with cisplatin in GPR81 silenced cells, and peaked at the highest concentration of cisplatin, which was 1.63-fold higher than the control (Fig. 3B and E). The expression of TOMM20 in the shRNA-scramble group increased slightly after being stimulated with cisplatin, with no significant difference compared with untreated cells. However, the expression of TOMM20 increased significantly at 2 and 5 µg/ml cisplatin (P<0.05; Fig. 3E). This suggested that OXPHOS might be affected by GPR81 and cisplatin treatment, through changes in the expression of TOMM20.

The expression of MCT1 gradually increased in both groups stimulated by cisplatin. In addition, there was no significant difference compared with untreated cells, indicating that MCT1 was not affected by GPR81 after challenge with cisplatin (Fig. 3C and F).

At the protein level, PFK-1 expression in GPR81 knockdown cells markedly decreased after cisplatin treatment (lowest value ~0.29-fold of control at the highest concentration of cisplatin). However, the expression of PFK-1 in the shRNA-scramble group was increased after cisplatin challenge (Fig. 4A and B). The expression of PFK-1 with 2 and 5 µg/ml cisplatin incubation in shRNA-GPR81 and shRNA-scramble groups exhibited a significant difference (P<0.05). These results indicated that GPR81 affected the levels of PFK-1, which in turn might inhibit glycolysis following challenge with cisplatin.

For TOMM20, the total expression trend of the protein level was similar to that of the mRNA level, with a slight upregulation in both shRNA-GPR81 and shRNA-scramble groups. TOMM20 protein expression was the highest at a concentration of 2 µg/ml cisplatin. The expression of TOMM20 in shRNA-GPR81 was significantly higher compared with the shRNA-scramble group (P<0.05) after challenge with 22 µg/ml cisplatin. These results suggested that cisplatin stimulation might enhance the process of OXPHOS in cancer cells (Fig. 4C and D).

The expression of MCT1 in two groups manifested upregulation following cisplatin incubation. However, the expression of MCT1 in shRNA-scramble group was significantly higher than that in shRNA-GPR81 group after stimulation by 0.5 and 1 µg/ml cisplatin (P<0.05), and significant differences were found after stimulation by 2 and 5 µg/ml cisplatin (P<0.01; Fig. 4E and F).

GPR81 silencing combined with cisplatin promotes apoptosis in FaDu cells

The mRNA expression profile of caspase-3 and Bcl-2 in GPR81-silenced cells after cisplatin stimulation was also assessed (Fig. 5). In both the shRNA-GPR81 silencing group and shRNA-scramble group, the expression of caspase-3 was gradually elevated, to a peak at 5 µg/ml of cisplatin. Following incubation with 2 and 5 µg/ml cisplatin, the expression of caspase-3 in shRNA-GPR81 and shRNA-scramble groups showed a significant difference (P<0.05). For the Bcl-2 gene, mRNA expression decreased in shRNA-GPR81 and shRNA-scramble groups, to ~0.1 and 0.3-fold of the untreated cells group. A significant difference in the expression of Bcl-2 was observed in the shRNA-GPR81 and shRNA-scramble groups at 2 and 5 µg/ml cisplatin (P<0.05). These results suggested that GPR81 affected apoptosis following cisplatin treatment. Flow cytometry analyses showed that the apoptotic cell rate of the shRNA-GPR81 group was higher than that of the shRNA-scramble group (P<0.05; Fig. 6). The results indicated that GPR81 combined with cisplatin enhanced apoptosis in cancer cells.

Discussion

The present study demonstrated the influence of GPR81 on energy metabolism and apoptosis in hypopharyngeal carcinoma in vitro, using an shRNA interference technique combined with the chemotherapeutic agent cisplatin. The results of the present study suggested that GPR81 gene knockdown inhibited cell proliferation and invasion. Moreover, GPR81 silencing combined with cisplatin affects the expression of PFK-1, TOMM20 and MCT1, which are involved in energy metabolism and lactate transport. Furthermore, cisplatin treatment increased apoptosis in GPR81-silenced cells, as indicated by altered levels ofcaspase-3. Altogether, the findings of the present study suggested that GPR81 knockdown might increase the efficacy of chemotherapy agents, such as cisplatin, enhance apoptosis and influence the pathways related to energy metabolism.

As a crucial lactate receptor, GPR81 directly affects metabolites involved in tumor cell survival and energy metabolism, altering the uptake of glucose and modulating the normal process in mammalian organisms by activating various receptors (28). A similar observation regarding the role of GPR81 was made in breast cancer and pancreatic carcinoma cell lines (29,30). These previous studies indicated that the absence of GPR81 in breast cancer cells and pancreatic carcinoma cell lines markedly decreased cell proliferation and invasion, leading to cell death in vitro.

GPR81 also functions as a vital regulator of cell survival by inhibiting apoptosis and promoting cell survival (19,18). In the present study, it was hypothesized that the inhibition of GPR81 on cell proliferation would depend on apoptosis. Cisplatin is a conventional chemotherapeutic reagent used in the treatment of various tumor types (30), and blocks malignant cell growth through various mechanisms, such as DNA damage, cell cycle deregulation, apoptosis and autophagy (3133). Our previous study demonstrated that cisplatin treatment enhanced apoptosis in FaDu cells (34). GPR81 knockdown in FaDu cells led to an increase in apoptosis in the presence of cisplatin. In the present study, the proportion of apoptotic cells was also significantly increased in shRNA-GPR81 FaDu cells. In addition, the expression of caspase-3 increased, while the expression of Bcl-2 decreased in the presence of cisplatin. A similar conclusion regardingGPR81 was also previously suggested in HeLa cells, demonstrating that silencing GPR81 accelerated apoptosis in another in vitro system (16). Therefore, GPR81 regulates survival and apoptosis in hypopharyngeal carcinoma cells.

The coexistence of glycolysis with the generation of lactate and mitochondrial OXPHOS is a hallmark in carcinoma cells (35,36). Lactate is a vital bridge in energy metabolism. The lack of the lactate receptor GPR81 would affect the content of lactate and ultimately influence biological metabolism. The present study examined whether the absence of GPR81 and cisplatin stimulation would have an impact on glycolysis and OXPHOS by detecting key markers at the mRNA and protein levels. It was demonstrated that shRNA-GPR81 combined with cisplatin decreased PFK-1 mRNA and protein levels, but increased TOMM20 and MCT1 mRNA and protein levels to varying degrees. PFK-1 is essential for glycolysis, as it catalyzes rate-limiting steps of fructose 6-phosphate and ATP conversion into fructose 1,6-bisphosphate and ADP (37). A previous study identified that cisplatin treatment decreased glycolysis by inhibiting PFK-1 expression (38). In the present study, the importance of GPR81 in triggering cisplatin efficacy and weakening the glycolysis pathway was demonstrated in HSCC. Thus, reduced expression of PFK-1 could contribute to the alteration of lactate, allowing tumor cells to alter glycolysis to survive in a complex micro-environment.

TOMM20, a pivotal translocase located in the outer mitochondrial membrane, has been reported as susceptible to cisplatin. In addition, the protein level of TOMM20 was increased when incubated with cisplatin in cholangiocarcinoma cells (39). However, the relationship between GPR81 and TOMM20 is still ambiguous. In our previous study, cisplatin induced a slight downregulation of TOMM20 in FaDu cells (34). In the present study, the elevated mRNA and protein levels of TOMM20 could be caused by changes in GPR81levels in the presence of cisplatin.

MCT1 is involved in cellular uptake of lactate. The expression of MCT1 is induced by lactate, and accumulation of lactate also increases the expression of MCT1 (40). The absence of GPR81 affects lactate binding, leading to lactate accumulation in cells. Moreover, expression of MCT1 was correlated with cisplatin-resistance in epithelial ovarian tumors (41). In epithelial ovarian tumors, the expression of MCT1 was enhanced after treatment with cisplatin. Hu et al (42) demonstrated that both GPR81 and MCT1 were highly expressed in squamous carcinoma; however, the expression of GPR81 and MCT1 had no association in squamous carcinoma. In the present study, MCT1 showed a marginal increase in GPR81-silenced cells and after cisplatin treatment. Thus, depletion of GPR81could change the concentration of lactate, which would indirectly influence the process of lactate uptake. Finally, changes in the expression of MCT1 were due to a combined effect of GPR81 and cisplatin.

In summary, the present study suggested a critical role for GPR81 in hypopharyngeal carcinoma following cisplatin treatment. Moreover, the present study provided an insight into the mechanism underlying the cellular metabolism and resistance to cisplatin through PFK-1, TOMM20 and MCT1. Notably, GPR81 was crucial for cell proliferation and invasion, which may account for the changes in energy metabolism alteration seen in hypopharyngeal cancer.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

The research was supported by Excellent Talents Plan Foundation of Hebei province (grant no. 361004) and Hebei province Natural Science Foundation (grant no. H2016206535).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JW performed the of cell culture and cell challenge. OX performed the of semi-quantitative PCR and analyzed the data. JD designed the sequence of primers used in the present study. XJ performed the RNA extraction and protein lysis. QJ performed cell transfection, cell proliferation, invasion, western blotting and apoptosis assays, and was a major contributor in writing the manuscript. XR analyzed the western blotting data and revised the manuscript. CS designed the present study and revised the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Cohen N, Fedewa S and Chen AY: Epidemiology and demographics of the head and neck cancer population. Oral Maxillofac Surg Clin North Am. 30:381–395. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Bradley PJ: Epidemiologyz of hypopharyngeal cancer. Adv Otorhinolaryngol. 83:1–14. 2019.PubMed/NCBI

3 

Znaor A, Brennan P, Gajalakshmi V, Mathew A, Shanta V, Varghese C and Boffetta P: Independent and combined effects of tobacco smoking, chewing and alcohol drinking on the risk of oral, pharyngeal and esophageal cancers in Indian men. Int J Cancer. 105:681–686. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Mehanna H, Beech T, Nicholson T, El-Hariry I, McConkey C, Paleri V and Roberts S: Prevalence of human papillomavirus in oropharyngeal and nonoropharyngeal head and neck cancer-systematic review and meta-analysis of trends by time and region. Head Neck. 35:747–755. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Newman JR, Connolly TM, Illing EA, Kilgore ML, Locher J and Carroll WR: Survival trends in hypopharyngeal cancer: A population-based review. Laryngoscope. 125:624–629. 2015. View Article : Google Scholar : PubMed/NCBI

6 

American Cancer Society: Laryngeal and hypopharyngeal cancer. simplehttp://www.cancer.org/cancer/laryngealandhypopharyngealcancer/indexJanuary 4–2015

7 

Hanahan D and Weinberg RA: Hallmarks of cancer: The next generation. Cell. 144:646–674. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Moreno-Sánchez R, Rodríguez-Enríquez S, Marín-Hernández A and Saavedra E: Energy metabolism in tumor cells. FEBS J. 274:1393–1418. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Fantin VR, St-Pierre J and Leder P: Attenuation of LDH-A expression uncovers a link between glycolysis, mitochondrial physiology, and tumor maintenance. Cancer Cell. 9:425–434. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Díaz-Muñiz I, Banavara DS, Budinich MF, Rankin SA, Dudley EG and Steele JL: Lactobacillus casei metabolic potential to utilize citrate as an energy source in ripening cheese: A bioinformatics approach. J Appl Microbiol. 101:872–882. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Brodsky AN, Odenwelder DC and Harcum SW: High extracellular lactate causes reductive carboxylation in breast tissue cell lines grown under normoxic conditions. PLoS One. 14:e02134192019. View Article : Google Scholar : PubMed/NCBI

12 

Grasmann G, Smolle E, Olschewski H and Leithner K: Gluconeogenesis in cancer cells-Repurposing of a starvation-induced metabolic pathway? Biochim Biophys Acta Rev Cancer. 1872:24–36. 2019. View Article : Google Scholar : PubMed/NCBI

13 

Liu C, Wu J, Zhu J, Kuei C, Yu J, Shelton J, Sutton SW, Li X, Yun SJ, Mirzadegan T, et al: Lactate inhibits lipolysis in fat cells through activation of an orphan G-protein-coupled receptor, GPR81. J Biol Chem. 284:2811–2822. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Rooney K and Trayhurn P: Lactate and the GPR81 receptor in metabolic regulation: Implications for adipose tissue function and fatty acid utilisation by muscle during exercise. Br J Nutr. 106:1310–1316. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Morland C, Lauritzen KH, Puchades M, Holm-Hansen S, Andersson K, Gjedde A, Attramadal H, Storm-Mathisen J and Bergersen LH: The lactate receptor, G-protein-coupled receptor 81/hydroxycarboxylic acid receptor 1: Expression and action in brain. J Neurosci Res. 93:1045–1055. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Wagner W, Kania KD, Blauz A and Ciszewski WM: The lactate receptor (HCAR1/GPR81) contributes to doxorubicin chemoresistance via ABCB1 transporter up-regulation in human cervical cancer HeLa cells. J Physiol Pharmacol. 68:555–564. 2017.PubMed/NCBI

17 

Feng J, Yang H, Zhang Y, Wei H, Zhu Z, Zhu B, Yang M, Cao W, Wang L and Wu Z: Tumor cell-derived lactate induces TAZ-dependent upregulation of PD-L1 through GPR81 in human lung cancer cells. Oncogene. 36:5829–5839. 2017. View Article : Google Scholar : PubMed/NCBI

18 

Roland CL, Arumugam T, Deng T, Liu SH, Philip B, Gomez S, Burns WR, Ramachandran V, Wang H, Cruz-Monserrate Z and Logsdon CD: Cell surface lactate receptor GPR81 is crucial for cancer cell survival. Cancer Res. 74:5301–5310. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Caslin HL, Abebayehu D, Abdul Qayum A, Haque TT, Taruselli MT, Paez PA, Pondicherry N, Barnstein BO, Hoeferlin LA, Chalfant CE and Ryan JJ: Lactic acid inhibits lipopolysaccharide-induced mast cell function by limiting glycolysis and ATP availability. J Immunol. 203:453–464. 2019. View Article : Google Scholar : PubMed/NCBI

20 

Ideno M, Kobayashi M, Sasaki S, Futagi Y, Narumi K, Furugen A and Iseki K: Involvement of monocarboxylate transporter 1 (SLC16A1) in the uptake of l-lactate in human astrocytes. Life Sci. 192:110–114. 2018. View Article : Google Scholar : PubMed/NCBI

21 

Curry JM, Tuluc M, Whitaker-Menezes D, Ames JA, Anantharaman A, Butera A, Leiby B, Cognetti DM, Sotgia F, Lisanti MP, et al: Cancer metabolism, stemness and tumor recurrence: MCT1 and MCT4 are functional biomarkers of metabolic symbiosis in head and neck cancer. Cell Cycle. 12:1371–1384. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Yuan Y, Guo-Qing P, Yan T, Hong-Lin Y, Gong-Hua H and Cai-Gao Z: A study of PKM2, PFK-1, and ANT1 expressions in cervical biopsy tissues in China. Med Oncol. 29:2904–2910. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Gooptu M, Whitaker-Menezes D, Sprandio J, Domingo-Vidal M, Lin Z, Uppal G, Gong J, Fratamico R, Leiby B, Dulau-Florea A, et al: Mitochondrial and glycolytic metabolic compartmentalization in diffuse large B-cell lymphoma. Semin Oncol. 44:204–217. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Sotgia F, Whitaker-Menezes D, Martinez-Outschoorn UE, Flomenberg N, Birbe RC, Witkiewicz AK, Howell A, Philp NJ, Pestell RG and Lisanti MP: Mitochondrial metabolism in cancer metastasis: Visualizing tumor cell mitochondria and the ‘reverse Warburg effect’ in positive lymph node tissue. Cell Cycle. 11:1445–1454. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Zhao Z, Han F, He Y, Yang S, Hua L, Wu J and Zhan W: Stromal-epithelial metabolic coupling in gastric cancer: Stromal MCT4 and mitochondrial TOMM20 as poor prognostic factors. Eur J Surg Oncol. 40:1361–1368. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Park SH, Lee AR, Choi K, Joung S, Yoon JB and Kim S: TOMM20 as a potential therapeutic target of colorectal cancer. BMB Rep. 52:712–717. 2019. View Article : Google Scholar : PubMed/NCBI

27 

Duan K, Liu ZJ, Hu SQ, Huo HY, Xu ZR, Ruan JF, Sun Y, Dai LP, Yan CB, Xiong W, et al: Lactic acid induces lactate transport and glycolysis/OXPHOS interconversion in glioblastoma. Biochem Biophys Res Commun. 503:888–894. 2018. View Article : Google Scholar : PubMed/NCBI

28 

Brown TP and Ganapathy V: Lactate/GPR81 signaling and proton motive force in cancer: Role in angiogenesis, immune escape, nutrition, and Warburg phenomenon. Pharmacol Ther. 206:1074512020. View Article : Google Scholar : PubMed/NCBI

29 

Lee YJ, Shin KJ, Park SA, Park KS, Park S, Heo K, Seo YK, Noh DY, Ryu SH and Suh PG: G-protein-coupled receptor 81 promotes a malignant phenotype in breast cancer through angiogenic factor secretion. Oncotarget. 7:70898–70911. 2016. View Article : Google Scholar : PubMed/NCBI

30 

Rancoule C, Guy JB, Vallard A, Ben Mrad M, Rehailia A and Magné N: 50th anniversary of cisplatin. Bull Cancer. 104:167–176. 2017. View Article : Google Scholar : PubMed/NCBI

31 

Zhang K, Zhang B, Bai Y and Dai L: E2F1 promotes cancer cell sensitivity to cisplatin by regulating the cellular DNA damage response through miR-26b in esophageal squamous cell carcinoma. J Cancer. 11:301–310. 2020. View Article : Google Scholar : PubMed/NCBI

32 

Shi S, Tan P, Yan B, Gao R, Zhao J, Wang J, Guo J, Li N and Ma Z: ER stress and autophagy are involved in the apoptosis induced by cisplatin in human lung cancer cells. Oncol Rep. 35:2606–2614. 2016. View Article : Google Scholar : PubMed/NCBI

33 

Zheng AW, Chen YQ, Fang J, Zhang YL and Jia DD: Xiaoaiping combined with cisplatin can inhibit proliferation and invasion and induce cell cycle arrest and apoptosis in human ovarian cancer cell lines. Biomed Pharmacother. 89:1172–1177. 2017. View Article : Google Scholar : PubMed/NCBI

34 

Xu O, Jia QJ, Wang JX and Shan C: A preliminary study on the function of GPR81 and TOMM20 in hypopharyngeal carcinoma. Chin J Otorhinolaryngol Skull Base Surg. 25:498–503. 2019.

35 

Ashton TM, McKenna WG, Kunz-Schughart LA and Higgins GS: Oxidative phosphorylation as an emerging target in cancer therapy. Clin Cancer Res. 24:2482–2490. 2018. View Article : Google Scholar : PubMed/NCBI

36 

Bottoni P and Scatena R: Mitochondrial metabolism in cancer. A tangled topic. Which role for proteomics? Adv Exp Med Biol. 1158:1–16. 2019. View Article : Google Scholar : PubMed/NCBI

37 

Mor I, Cheung EC and Vousden KH: Control of glycolysis through regulation of PFK-1: Old friends and recent additions. Cold Spring Harb Symp Quant Biol. 76:211–216. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Marín-Hernández A, Gallardo-Pérez JC, López-Ramírez SY, García-García JD, Rodríguez-Zavala JS, Ruiz-Ramírez L, Gracia-Mora I, Zentella-Dehesa A, Sosa-Garrocho M, Macías-Silva M, et al: Casiopeina II-gly and bromo-pyruvate inhibition of tumor hexokinase, glycolysis, and oxidative phosphorylation. Arch Toxicol. 86:753–766. 2012. View Article : Google Scholar : PubMed/NCBI

39 

Fan Z, Yu H, Cui N, Kong X, Liu X, Chang Y, Wu Y, Sun L and Wang G: ABT737 enhances cholangiocarcinoma sensitivity to cisplatin through regulation of mitochondrial dynamics. Exp Cell Res. 335:68–81. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Lottes RG, Newton DA, Spyropoulos DD and Baatz JE: Lactate as substrate for mitochondrial respiration in alveolar epithelial type II cells. Am J Physiol Lung Cell Mol Physiol. 308:L953–L961. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Yan C, Yang F, Zhou C, Chen X, Han X, Liu X, Ma H and Zheng W: MCT1 promotes the cisplatin-resistance by antagonizing Fas in epithelial ovarian cancer. Int J Clin Exp Pathol. 8:2710–2718. 2015.PubMed/NCBI

42 

Hu Y and Zeng F: Expressions of GPR81, MCT1 and MCT4 in squamous carcinoma and their clinical significance. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 43:950–956. 2018.(In Chinese). PubMed/NCBI

Related Articles

Journal Cover

September-2020
Volume 22 Issue 3

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Jia Q, Xu O, Wang J, Dong J, Ren X, Jia X and Shan C: Effects of GPR81 silencing combined with cisplatin stimulation on biological function in hypopharyngeal squamous cell carcinoma. Mol Med Rep 22: 1727-1736, 2020
APA
Jia, Q., Xu, O., Wang, J., Dong, J., Ren, X., Jia, X., & Shan, C. (2020). Effects of GPR81 silencing combined with cisplatin stimulation on biological function in hypopharyngeal squamous cell carcinoma. Molecular Medicine Reports, 22, 1727-1736. https://doi.org/10.3892/mmr.2020.11255
MLA
Jia, Q., Xu, O., Wang, J., Dong, J., Ren, X., Jia, X., Shan, C."Effects of GPR81 silencing combined with cisplatin stimulation on biological function in hypopharyngeal squamous cell carcinoma". Molecular Medicine Reports 22.3 (2020): 1727-1736.
Chicago
Jia, Q., Xu, O., Wang, J., Dong, J., Ren, X., Jia, X., Shan, C."Effects of GPR81 silencing combined with cisplatin stimulation on biological function in hypopharyngeal squamous cell carcinoma". Molecular Medicine Reports 22, no. 3 (2020): 1727-1736. https://doi.org/10.3892/mmr.2020.11255