Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
May-2024 Volume 29 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2024 Volume 29 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

RICH1 is a novel key suppressor of isoproterenol‑ or angiotensin II‑induced cardiomyocyte hypertrophy

  • Authors:
    • Siqi Wang
    • Xin Wang
    • Li Ling
    • Cairong Li
    • Zhanhong Ren
  • View Affiliations / Copyright

    Affiliations: School of Pharmacy, Xianning Medical College, Hubei University of Science and Technology, Xianning, Hubei 437100, P.R. China, School of Mathematics and Statistics, Hubei University of Science and Technology, Xianning, Hubei 437100, P.R. China, School of Clinical Medicine, Xianning Medical College, Hubei University of Science and Technology, Xianning, Hubei 437100, P.R. China, Hubei Key Laboratory of Diabetes and Angiopathy, Medicine Research Institute, Xianning Medical College, Hubei University of Science and Technology, Xianning, Hubei 437100, P.R. China
    Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 69
    |
    Published online on: March 4, 2024
       https://doi.org/10.3892/mmr.2024.13193
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Cardiac hypertrophy is one of the key processes in the development of heart failure. Notably, small GTPases and GTPase‑activating proteins (GAPs) serve essential roles in cardiac hypertrophy. RhoGAP interacting with CIP4 homologs protein 1 (RICH1) is a RhoGAP that can regulate Cdc42/Rac1 and F‑actin dynamics. RICH1 is involved in cell proliferation and adhesion; however, to the best of our knowledge, its role in cardiac hypertrophy remains unknown. In the present study, the role of RICH1 in cardiomyocyte hypertrophy was assessed. Cell viability was analyzed using the Cell Counting Kit‑8 assay and cells surface area (CSA) was determined by cell fluorescence staining. Reverse transcription‑quantitative PCR and western blotting were used to assess the mRNA expression levels of hypertrophic marker genes, such as Nppa, Nppb and Myh7, and the protein expression levels of RICH1, respectively. RICH1 was shown to be downregulated in isoproterenol (ISO)‑ or angiotensin II (Ang II)‑treated H9c2 cells. Notably, overexpression of RICH1 attenuated the upregulation of hypertrophy‑related markers, such as Nppa, Nppb and Myh7, and the enlargement of CSA induced by ISO and Ang II. By contrast, the knockdown of RICH1 exacerbated these effects. These findings suggested that RICH1 may be a novel suppressor of ISO‑ or Ang II‑induced cardiomyocyte hypertrophy. The results of the present study will be beneficial to further studies assessing the role of RICH1 and its downstream molecules in inhibiting cardiac hypertrophy.

Introduction

Cardiac hypertrophy is an early pathological structural feature of heart failure, and is a risk factor for cardiac dysfunction, arrhythmia and myocardial infarction (1). It is characterized by an increase in heart mass and individual cardiomyocyte volume, which is accompanied by reactivated fetal genes, increased protein synthesis and altered metabolism (1,2). Research into the molecular mechanisms of cardiac hypertrophy serve a role in preventing and treating cardiomyopathy and heart failure (1,2). However, there are few feasible targets, such as Rho and Rho-associated kinase (ROCK), for preventing or reversing cardiac hypertrophy (3).

It has been reported that small GTPases are involved in the development of cardiac hypertrophy (3–6). Small GTPases are molecular switches that either exist in the active GTP-bound or inactive GDP-bound states (7–9). Small GTPases are divided into subfamilies, including Ras, Rho, Rab, Ran and Arf/Sar (10). Activated Ras and the upregulation of Rab1 are causes of cardiac hypertrophy (5,6). Conversely, inactivation of RhoA can suppress cardiac hypertrophy (11,12). GTPase-activating proteins (GAPs) can induce inactivation of small GTPases by inducing GTP hydrolysis (13,14). Notably, the inhibitory roles of RabGAPs and RasGAPs in cardiac hypertrophy have previously been reported (15–18). The ablation of the RabGAP TBC1 domain family member 1 results in significant cardiac hypertrophy in male rats and increased myocardial damage after ischemia/reperfusion (15,16). Similarly, depletion of Carabin, another RabGAP, can exacerbate cardiac hypertrophy and significantly reduce fractional shortening in mice (17,18). Furthermore, the RasGAP neurofibromatosis type 1 (NF1) is involved in cardiac hypertrophy. It has been reported that the cardiomyocyte-specific NF1 knockout promotes cardiac hypertrophy and dysfunction in mice (19). However, compared with RabGAPs and RasGAPs, the role of RhoGAPs in cardiac hypertrophy is unclear.

RhoGAP interacting with CIP4 homologs protein 1 (RICH1) is a RhoGAP that is also known as ARHGAP17. RICH1 contains three functional domains: An N-terminal BAR domain; a RhoGAP domain; and a C-terminal tail consisting of multiple proline-rich motifs (20,21). RICH1 is a selective GAP of Cdc42 and Rac1, and associates with tight junctions in epithelial cells (21,22). The GAP activity of RICH1 and regulation of Cdc42 by RICH1 is required for maintaining proper tight junctions in epithelial cells (21). RICH1 is widely distributed and highly expressed in human heart and placenta tissues (23), and it has been reported that RICH1 has multiple functions in vivo (24–26). RICH1 can inhibit the activity of Rac1 by catalyzing the cleavage of Rac1-GTP to Rac1-GDP, which then inhibits the MAPK signaling pathway, which in turn reduces cellular proliferation and tumorigenesis (27,28). It has been reported that the overexpression of RICH1 inhibits the invasion and metastasis of breast cancer through downregulating Hippo signaling (29). However, the role of RICH1 in cardiac hypertrophy remains unknown. The present study aimed to clarify whether RICH1 is associated with myocardial cell hypertrophy and how it serves a role in myocardial cell hypertrophy.

Materials and methods

Cell culture and treatments

The H9c2 cardiomyocyte cell line was purchased from Procell Life Science & Technology Co., Ltd. Cells were maintained in high-glucose Dulbecco's modified Eagle's medium (DMEM; Procell Life Science & Technology Co., Ltd.) containing 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin (Biosharp Life Sciences) in a 5% CO2 incubator at 37°C. To induce the cardiomyocyte hypertrophy model, H9c2 cells were treated with either 60 µM ISO (MilliporeSigma) dissolved in phosphate-buffered saline (PBS) for 48 h, or 3 µM Ang II (Shanghai Yuanye Biotechnology Co., Ltd.) in PBS for 24 h in a 5% CO2 incubator at 37°C. The control group cells were treated with an equal volume of PBS in a 5% CO2 incubator at 37°C for 48 h (when compared with ISO) and 24 h (when compared with Ang II).

Small interfering (si)RNA transfection of H9c2 cells

H9c2 cells were transfected with 1 µg/ml siRICH1 using siRNA-Mate (Shanghai GenePharma Co., Ltd.) and incubated in 5% CO2 at 37°C for 6 h, according to the manufacturer's instructions. A total of 18 h after the 6-h transfection, cells were treated with 60 µM ISO and incubated in a 5% CO2 incubator at 37°C for 48 h. A total of 42 h after the 6-h transfection, 3 µM Ang II was added and incubated in a 5% CO2 incubator at 37°C for 24 h. The siRNA sequences were as follows: siRICH1 (Shanghai GenePharma Co., Ltd.) sense, 5′-GGUGAAGAAGGAGAGCUUUTT-3′ and anti-sense, 5′-AAAGCUCUCCUUCUUCACCTT-3′; and negative control (siNC; Suzhou GenePharma Co., Ltd.) sense, 5′-UUCUCCGAACGUGUCACGUTT-3′ and anti-sense, 5′-ACGUGACACGUUCGGAGAATT-3′.

Plasmid transfection of H9c2 cells

H9c2 cells were transfected with 3 µg/ml pCDNA3.1-RICH1 plasmid (TsingKe Biological Technology) with siRNA-Mate and incubated in 5% CO2 at 37°C for 6 h to overexpress RICH1. Cells transfected with 3 µg/ml pCDNA3.1 plasmid (TsingKe Biological Technology) were used as a control. A total of 18 h after the 6-h transfection, cells were treated with 60 µM ISO and incubated in a 5% CO2 incubator at 37°C for 48 h. A total of 42 h after the 6-h transfection, 3 µM Ang II was added and incubated in a 5% CO2 incubator at 37°C for 24 h.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was isolated from the cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), after which, 1 µg RNA was reverse transcribed into cDNA using an ABScript III RT Master Mix (ABclonal Biotech Co., Ltd.) according to the manufacturer's protocol. After RT, qPCR was performed using a SYBR Green PCR kit (ABclonal Biotech Co., Ltd.) The amplification procedure was as follows: Pre-denaturation at 95°C for 3 min, followed by 45 cycles at 95°C for 5 sec and 60°C for 30 sec. mRNA expression levels were quantified using the 2−ΔΔCq method (30). Data were normalized to Gapdh. Primer sequences are shown in Table I.

Table I.

Primer sequences.

Table I.

Primer sequences.

GeneSpeciesForward primer, 5′-3′Reverse primer, 5′-3′
NppaRat GAAGATGCCGGTAGAAGATGAG AGAGCCCTCAGTTTGCTTTTC
NppbRat CTGGAGACTGGCTAGGACTTC GGTGCTGCCCCAGATGATT
Myh7Rat GCCCCAAATGCAGCCAT CGCTCAGTCATGGCGGAT
GapdhRat GGTTGTCTCCTGCGACTTCA TGGTCCAGGGTTACTCC
Western blotting

Total protein was extracted from H9c2 cells using RIPA lysis buffer containing phosphatase inhibitors and protease inhibitors (Wuhan Servicebio Technology Co., Ltd.). Protein concentration was determined using the BCA protein assay kit (Wuhan Servicebio Technology Co., Ltd.). Proteins (15 µg/lane) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 10% gels and were transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% skimmed milk in 1X TBS-0.5% Tween 20 (Biosharp Life Sciences) for 1 h at room temperature. The blots were then incubated with primary antibodies against RICH1 (1:500; cat. no. sc-514438; Santa Cruz Biotechnology, Inc.) and α-tubulin (1:2,000; cat. no. GB15201; Wuhan Servicebio Technology Co., Ltd.) overnight at 4°C, followed by anti-mouse horseradish peroxidase-conjugated secondary antibodies (1:50,000; cat. no. BL001A; Biosharp Life Sciences) or anti-rabbit horseradish peroxidase-conjugated secondary antibodies (1:50,000; cat. no. BL003A; Biosharp Life Sciences) for 1 h at room temperature. Protein bands were visualized using a Chemiluminescence Kit (Biosharp Life Sciences). Bio-ID software (Version 6.0; Bio-Rad Laboratories, Inc.) was used to semi-quantify protein expression.

Cell viability

Cell viability was assessed using Cell Counting Kit-8 (CCK-8; Biosharp Life Sciences). H9c2 cells were seeded in 96-well plates at 5×103 cells/well. After culturing for 24 h, cells were treated with different concentrations of ISO (0, 20, 40, 60, 80 and 100 µM) for 48 h or Ang II (0, 1, 2, 3, 4 and 5 µM) for 24 h at 37°C. The cells were then incubated with 10% CCK-8 solution in DMEM for 1 h and the absorbance was measured at 450 nm.

Cell fluorescence staining

H9c2 cells were seeded into 35-mm cell culture dishes at 4×104 cells/dish. Cells were fixed with 4% paraformaldehyde at 37°C for 20 min and then permeabilized with 0.1% Triton X-100 in PBS at 37°C for 15 min. Cells were incubated with Acti-stain™ 488 phalloidin (Cytoskeleton, Inc.) in the dark for 30 min at 37°C. ProLong™ Gold antifade reagent was mixed with DAPI (Invitrogen; Thermo Fisher Scientific, Inc.) for 30 min at 37°C and used for nuclear staining. Images were captured using an Olympus FV3000 confocal microscope (Olympus Corporation). Cell surface area (CSA) was calculated using CellSens software (Version 4.2.1; Olympus Corporation).

Statistical analysis

Experiments were repeated at least three times and statistical analyses were performed using GraphPad Prism 9 (Dotmatics). Before analysis, data were tested for normality and homogeneity using Shapiro-Wilk and Levene's tests, respectively. Data were analyzed by unpaired Student's t-test to compare the differences between two groups and one-way ANOVA with Tukey's post hoc test to compare the means among >2 groups. P<0.05 was considered to indicate a statistically significant difference

Results

RICH1 is downregulated in ISO- or Ang II-treated cardiomyocytes

ISO or Ang II are two common inducers of myocardial cell hypertrophy. In this study, ISO or Ang II were used to induce cardiomyocyte hypertrophy and to verify whether the expression levels of RICH1 were changed under the induction of ISO or Ang II. Notably, 0, 20, 40, 60 and 80 µM ISO, or 0, 1, 2, 3, 4 and 5 µM Ang II were demonstrated to have no negative effect on cell viability at the concentrations tested (Fig. S1). According to these cell viability experiments results, the protein expression levels of RICH1 were assessed after treatment with ISO or Ang II at different concentrations, which have no negative effect on cell viability. In particular, the protein expression levels of RICH1 were significantly decreased in response to 60 µM ISO (Fig. S2A and C) and 3 µM Ang II (Fig. S2B and D). Therefore, these concentrations were selected for further experimentation, and it was verified that the protein expression levels of RICH1 were markedly decreased in 60 µM ISO-treated (Fig. 1A and C) and 3 µM Ang II-treated (Fig 1B and D) H9c2 cells. Therefore, it was suggested that RICH1 may serve a role in cardiomyocyte hypertrophy.

Figure 1.

RICH1 is downregulated in ISO- or Ang II-treated H9c2 cells. Western blotting results of RICH1 and α-tubulin in (A) ISO- and (B) Ang II-treated cells. H9c2 cells were treated with phosphate-buffered saline in the control group, and 60 µM ISO or 3 µM Ang II in the experimental groups, and total protein was extracted for western blotting. Statistical evaluation of protein expression in cells treated with (C) 60 µM ISO (n=8 experimental repeats/group) and (D) 3 µM Ang II (n=10 experimental repeats/group) normalized to α-tubulin in each group. Data were analyzed using unpaired Student's t-test and presented as the mean ± SEM. **P<0.01. ISO, isoproterenol; Ang II, angiotensin II; RICH1, Rho GTPase-activating protein interacting with CIP4 homologs protein 1.

RICH1 can attenuate ISO or Ang II-induced cardiomyocyte hypertrophy

To assess the role of RICH1 in cardiomyocyte hypertrophy, RICH1 was overexpressed in H9c2 cells by transfecting cells with pCDNA3.1-RICH1 plasmids. Compared with in the control group, the protein expression levels of RICH1 were significantly increased in the RICH1 overexpression group (Fig. 2A and B).

Figure 2.

Overexpression of RICH1 attenuates ISO- or Ang II-induced cardiomyocyte hypertrophy. (A) Protein expression levels of RICH1 in H9c2 cells transfected with pCDNA3.1-RICH1 plasmids were assessed by western blotting and (B) RICH1 expression was normalized to α-tubulin (n=8 experimental repeats/group). Data were analyzed by unpaired Student's t-test and presented as the mean ± SEM. H9c2 cells were stained with Acti-stain™ 488 phalloidin and captured using an Olympus FV3000 confocal microscope. Overexpression of RICH1 can inhibit the enlargement of CSA induced by (C) ISO or (D) Ang II. Scale bar, 40 µm. CSA quantification in response to (E) ISO (n=53/group) and (F) Ang II (n=39 number of cells assessed/group). This experiment was repeated three times. Data were analyzed by one-way ANOVA with Tukey's post hoc test and are presented as the mean ± SD. Reverse transcription-quantitative PCR was used to assess the expression levels of the cardiac hypertrophy-related genes (G and L) Nppa, (H and K) Nppb and (I and L) Myh7, which were normalized to Gapdh. Overexpression of RICH1 can inhibit the upregulation of cardiac hypertrophy marker genes induced by (G-I) ISO or (J-L) Ang II (n=5-6 experimental repeats/group). Data were analyzed using one-way ANOVA with Tukey's post hoc test and are presented as the mean ± SEM. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001. CSA, cell surface area; ISO, isoproterenol; Ang II, angiotensin II; OE, overexpression; Rho GTPase-activating protein interacting with CIP4 homologs protein 1.

The increase in CSA and upregulation of hypertrophy-related genes are two critical features of cardiomyocyte hypertrophy. Notably, it was demonstrated that CSA was significantly increased in ISO-treated (Fig. 2C and E) and Ang II-treated (Fig. 2D and F) cells compared with in the control group. There was no significant difference in CSA between the control group and the RICH1 overexpression group (Fig. 2C and E). Compared with in the ISO group, overexpression of RICH1 inhibited CSA. No difference in CSA was detected between the control group and the RICH1 overexpression group. However, the overexpression of RICH1 inhibited the CSA compared with that in the Ang II group (Fig. 2D and F).

Furthermore, the cardiac hypertrophy marker genes Nppa, Nppb and Myh7 were assessed by RT-qPCR. It was demonstrated that the relative mRNA expression levels of these genes were significantly increased in ISO- or Ang II-treated cells compared with those in the control groups, whereas they were significantly decreased following overexpression of RICH1 in ISO- or Ang II-treated cells compared with those in the ISO or Ang II single treatment groups, respectively (Fig. 2G-L). These results suggested that RICH1 can alleviate cardiomyocyte hypertrophy induced by ISO or Ang II.

KD of RICH1 can promote ISO or Ang II-induced cardiomyocyte hypertrophy

To further assess the role of RICH1 in ISO- and Ang II-induced cardiomyocyte hypertrophy, siRNA was used to KD RICH1 in H9c2 cells. First, a siRNA fragment that can induce RICH1 KD in H9c2 cells was identified (Fig. 3A and B). It was then demonstrated that RICH1 KD in ISO- and Ang II-treated cells resulted in a significantly larger CSA compared with that in ISO- and Ang II-treated cells transfected with the siNC, respectively (Fig. 3C-F). Similarly, the relative mRNA expression levels of the cardiac hypertrophy-related genes Nppa, Nppb and Myh7 were significantly higher in the siRICH1 + ISO group and siRICH1 + Ang II groups compared with those in the siNC + ISO and siNC + Ang II groups, respectively, as demonstrated by RT-qPCR (Fig. 3G-L). These results suggested that siRNA-mediated RICH1 KD can exacerbate cardiomyocyte hypertrophy induced by ISO or Ang II.

Figure 3.

siRNA-directed RICH1 knockdown exacerbates ISO- or Ang II-induced cardiomyocyte hypertrophy. (A) Protein expression levels of RICH1 in H9c2 cells transfected with siRICH1 and siNC were assessed by western blotting, and (B) RICH1 expression was normalized to α-tubulin (n=6 experimental repeats/group). Data were analyzed using one-way ANOVA with Tukey's post hoc test and are presented as the mean ± SEM. H9c2 cells were stained with Acti-stain™ 488 phalloidin and captured under an Olympus FV3000 confocal microscope. Knockdown of RICH1 enhanced the enlargement of CSA induced by (C) ISO or (D) Ang II. Scale bar, 40 µm. CSA quantification in response to (E) ISO (n=48 number of cells assessed/group) and (F) Ang II (n=55 number of cells assessed/group). This experiment was repeated three times. Data were analyzed using one-way ANOVA with Tukey's post hoc test and are presented as the mean ± SD. Expression levels of the cardiac hypertrophy-related genes (G and J) Nppa, (H and K) Nppb and (I and L) Myh7 treated with (G-I) ISO or (J-L) Ang II were assessed by reverse transcription-quantitative PCR and normalized to Gapdh (n=4-6 experimental repeats/group). Data were analyzed using one-way ANOVA with Tukey's post hoc test and are presented as the mean ± SEM. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001. CSA, cell surface area; ISO, isoproterenol; Ang II, angiotensin II; NC, negative control; si, small interfering; ns, not significant; RICH1, Rho GTPase-activating protein interacting with CIP4 homologs protein 1.

Discussion

Heart failure is the final stage of cardiovascular diseases, which results in high morbidity and mortality, and cardiac hypertrophy is an important stage in the occurrence of heart failure. Inhibiting cardiac hypertrophy is of great significance for preventing and alleviating heart failure. It has been reported that various signaling pathways, such as the MAPK/ERK, RhoA and PI3K/Akt/NF-κB pathways, are involved in cardiac hypertrophy (1,4–7). Previous studies have reported that RICH1 is a type of RhoGAP and a key regulatory factor in numerous signaling pathways, such as ERK and Rho signaling pathways, and diseases, including breast cancer (26,29,31). However, to the best of our knowledge, the relationship between RICH1 and cardiac hypertrophy has not been reported.

In the present study, it was demonstrated that RICH1 can act as a novel suppressor of ISO- or Ang II-induced cardiomyocyte hypertrophy. RICH1 was downregulated in ISO- or Ang II-induced cardiomyocyte hypertrophy, and the overexpression of RICH1 inhibited the increase in CSA and decreased the relative mRNA expression levels of cardiac hypertrophic markers, including Nppa, Nppb and Myh7, in ISO- or Ang II-treated H9c2 cells. By contrast, siRNA-mediated RICH1 KD exacerbated ISO- or Ang II-induced increases in CSA, as well as the expression of genes related to cardiomyocyte hypertrophy. The present study demonstrated that RICH1 may be a novel target in the development of treatments for cardiac hypertrophy. It has been reported that RICH1 can directly interact with small GTPases Cdc42 and Rac1, and serves a key role in Cdc42/Rac1/ERK1/2 signaling (32). Notably, RICH1 can inhibit the phosphorylation of ERK1/2 in epithelial cells through inactivating Cdc42 and Rac1 (30). It is thus implied that RICH1 may inhibit cardiac hypertrophy through regulating the Cdc42/Rac1/ERK1/2 signaling pathway.

Based on previous studies and the results of the present study, a prospective molecular mechanism by which RICH1 mediates cardiomyocyte hypertrophy has been proposed. It was demonstrated that RICH1 is downregulated in ISO- or Ang II-induced cardiomyocyte hypertrophy; therefore its downstream effectors, such as Cdc42 and Rac1, may remain active, thus leading to cardiomyocyte hypertrophy (Fig. 4). However, RICH1 overexpression may inactivate its downstream effectors and result in the attenuation of ISO or Ang II-induced cardiomyocyte hypertrophy (Fig. 4). To elucidate more detailed roles and mechanisms of RICH1 in cardiac hypertrophy, cardiac-specific overexpression or KD of RICH1 should be assessed in future studies.

Figure 4.

Schematic diagram of molecular mechanisms by which RICH1 mediates cardiomyocyte hypertrophy. Overexpression of RICH1 inhibited cardiomyocyte hypertrophy induced by ISO and Ang II. Active Rho GTPase proteins can positively promote the expression of cardiac hypertrophy-related genes, Nppa, Nppb and Myh7. RICH1 can induce the inactivation of Rho. Under the stimulation of ISO and Ang II, RICH1 is downregulated. Therefore, more Rho GTPase proteins remain active and enhance the expression of cardiomyocyte hypertrophy-related genes. When RICH1 is overexpressed, Rho GTPase proteins are inactivated and cardiac hypertrophy-related genes are downregulated. ISO, isoproterenol; Ang II, angiotensin II; RICH1, Rho GTPase-activating protein interacting with CIP4 homologs protein.

RICH1 is highly expressed in cardiac tissue (23), which implies that the maintenance of high concentrations of RICH1 may be important for myocardial structure and function; therefore, downregulation of RICH1 may trigger myocardial remodeling. The use of RICH1 could thus be beneficial as a prospective diagnostic indicator of myocardial hypertrophy; however, further studies are required. For example, it is worth testing what changes occur in downstream proteins or signaling molecules after the dysregulation of RICH1.

Previous studies have reported that autophagy; actin-binding proteins, such as cofilin, Formin and CapZ; and the MAPK/ERK signaling pathway serve roles in cardiac hypertrophy (33–35). It has been reported that autophagosome formation depends on small GTPases (36). In addition, small GTPases, such as Cdc42 and Rac1, are the upstream regulators of actin-binding proteins and the ERK signaling pathway (37,38). Likewise, the abnormal upregulation of Rho GTPase functions can induce cardiac hypertrophy. Fasudil, an inhibitor of ROCK, which is a RhoA effector, can inhibit cardiac remodeling and hypertrophy (39). In addition, vitamin D can inhibit the expression of Rac1 and alleviate pressure overload-induced cardiac hypertrophy (40), and statins can relieve cardiac hypertrophy by inhibiting Rac1-mediated oxidative stress (41). Molecular switches act as a critical and specific ‘brakes’ of Rho GTPases. RICH1 is upstream of Rho GTPases; therefore, RICH1 may be considered a promising therapeutic target for the treatment of cardiac hypertrophy. The present study provides insights into the molecular mechanisms underlying cardiac hypertrophy, which should be further assessed in future studies.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

This study was supported by the Natural Science Foundation of Hubei Province (grant no. 2022CFB843), the Xianning Science and Technology Plan Project (grant no. 2021ZRKX024), the Hubei University of Science and Technology School-level Fund (grant nos. BK202121 and BK202220), the Special Project on Diabetes and Angiopathy (grant no. 2022TNB04), the horizontal scientific research project of Hubei University of Science and Technology (grant no. 2022HX102) and the Scientific Research and Innovation Team of Hubei University of Science and Technology (grant no. 2022T01).

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

SW, LL and CL made substantial contributions to the conception or design of the work: acquisition, analysis and interpretation of data; drafting the work or reviewing it critically for important intellectual content; and finally approval of the version to be published; they also agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. XW completed and checked data statistics and analysis. ZR conceived, edited and finalized the manuscript. SW and ZR confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Bernardo BC, Weeks KL, Pretorius L and McMullen JR: Molecular distinction between physiological and pathological cardiac hypertrophy: Experimental findings and therapeutic strategies. Pharmacol Ther. 128:191–227. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Ritterhoff J and Tian R: Metabolic mechanisms in physiological and pathological cardiac hypertrophy: New paradigms and challenges. Nat Rev Cardiol. 20:812–829. 2023. View Article : Google Scholar : PubMed/NCBI

3 

Zeidan A, Javadov S and Karmazyn M: Essential role of Rho/ROCK-dependent processes and actin dynamics in mediating leptin-induced hypertrophy in rat neonatal ventricular myocytes. Cardiovasc Res. 72:101–111. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Rangrez AY, Bernt A, Poyanmehr R, Harazin V, Boomgaarden I, Kuhn C, Rohrbeck A, Frank D and Frey N: Dysbindin is a potent inducer of RhoA-SRF-mediated cardiomyocyte hypertrophy. J Cell Biol. 203:643–656. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Wu G, Yussman MG, Barrett TJ, Hahn HS, Osinska H, Hilliard GM, Wang X, Toyokawa T, Yatani A, Lynch RA, et al: Increased myocardial Rab GTPase expression: A consequence and cause of cardiomyopathy. Circ Res. 89:1130–1137. 2001. View Article : Google Scholar : PubMed/NCBI

6 

Ramos-Kuri M, Meka SH, Salamanca-Buentello F, Hajjar RJ, Lipskaia L and Chemaly ER: Molecules linked to Ras signaling as therapeutic targets in cardiac pathologies. Biol Res. 54:232021. View Article : Google Scholar : PubMed/NCBI

7 

Tcherkezian J and Lamarche-Vane N: Current knowledge of the large RhoGAP family of proteins. Biol Cell. 99:67–86. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Johnson DS and Chen YH: Ras family of small GTPases in immunity and inflammation. Curr Opin Pharmacol. 12:458–463. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Reiner DJ and Lundquist EA: Small GTPases. WormBook. 2018:1–65. 2018. View Article : Google Scholar : PubMed/NCBI

10 

Song S, Cong W, Zhou S, Shi Y, Dai W, Zhang H, Wang X, He B and Zhang Q: Small GTPases: Structure, biological function and its interaction with nanoparticles. Asian J Pharm Sci. 14:30–39. 2019. View Article : Google Scholar : PubMed/NCBI

11 

Aikawa R, Komuro I, Nagai R and Yazaki Y: Rho plays an important role in angiotensin II-induced hypertrophic responses in cardiac myocytes. Mol Cell Biochem. 212:177–182. 2000. View Article : Google Scholar : PubMed/NCBI

12 

Aikawa R, Komuro I, Yamazaki T, Zou Y, Kudoh S, Zhu W, Kadowaki T and Yazaki Y: Rho family small G proteins play critical roles in mechanical stress-induced hypertrophic responses in cardiac myocytes. Circ Res. 84:458–466. 1999. View Article : Google Scholar : PubMed/NCBI

13 

Schmidt A and Hall A: Guanine nucleotide exchange factors for Rho GTPases: Turning on the switch. Genes Dev. 16:1587–1609. 2002. View Article : Google Scholar : PubMed/NCBI

14 

Cherfils J and Zeghouf M: Regulation of small GTPases by GEFs, GAPs, and GDIs. Physiol Rev. 93:269–309. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Barbeau PA, Houad JM, Huber JS, Paglialunga S, Snook LA, Herbst EAF, Dennis KMJH, Simpson JA and Holloway GP: Ablating the Rab-GTPase activating protein TBC1D1 predisposes rats to high-fat diet-induced cardiomyopathy. J Physiol. 598:683–697. 2020. View Article : Google Scholar : PubMed/NCBI

16 

Binsch C, Barbosa DM, Hansen-Dille G, Hubert M, Hodge SM, Kolasa M, Jeruschke K, Weiß J, Springer C, Gorressen S, et al: Deletion of Tbc1d4/As160 abrogates cardiac glucose uptake and increases myocardial damage after ischemia/reperfusion. Cardiovasc Diabetol. 22:172023. View Article : Google Scholar : PubMed/NCBI

17 

Bisserier M, Berthouze-Duquesnes M, Breckler MS, Tortosa F, Fazal L, de Régibus A, Laurent AC, Varin A, Lucas A, Branchereau M, et al: Carabin protects against cardiac hypertrophy by blocking calcineurin, Ras, and Ca2+/calmodulin-dependent protein kinase II signaling. Circulation. 131:390–400. 2015. View Article : Google Scholar : PubMed/NCBI

18 

De Windt LJ, Lim HW, Bueno OF, Liang Q, Delling U, Braz JC, Glascock BJ, Kimball TF, del Monte F, Hajjar RJ and Molkentin JD: Targeted inhibition of calcineurin attenuates cardiac hypertrophy in vivo. Proc Natl Acad Sci USA. 98:3322–3327. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Xu J, Ismat FA, Wang T, Lu MM, Antonucci N and Epstein JA: Cardiomyocyte-specific loss of neurofibromin promotes cardiac hypertrophy and dysfunction. Circ Res. 105:304–311. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Richnau N, Fransson A, Farsad K and Aspenström P: RICH-1 has a BIN/Amphiphysin/Rvsp domain responsible for binding to membrane lipids and tubulation of liposomes. Biochem Biophys Res Commun. 320:1034–1042. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Wells CD, Fawcett JP, Traweger A, Yamanaka Y, Goudreault M, Elder K, Kulkarni S, Gish G, Virag C, Lim C, et al: A Rich1/Amot complex regulates the Cdc42 GTPase and apical-polarity proteins in epithelial cells. Cell. 125:535–548. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Nagy Z, Wynne K, von Kriegsheim A, Gambaryan S and Smolenski A: Cyclic nucleotide-dependent protein kinases target ARHGAP17 and ARHGEF6 complexes in platelets. J Biol Chem. 290:29974–29983. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Richnau N and Aspenström P: Rich, a rho GTPase-activating protein domain-containing protein involved in signaling by Cdc42 and Rac1. J Biol Chem. 276:35060–35070. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Pan SL, Deng YY, Fu J, Zhang YH, Zhang ZJ and Qin XJ: ARHGAP17 enhances 5-Fluorouracil-induced apoptosis in colon cancer cells by suppressing Rac1. Neoplasma. 69:640–647. 2022. View Article : Google Scholar : PubMed/NCBI

25 

Wang L, Yang X, Wan L, Wang S, Pan J and Liu Y: ARHGAP17 inhibits pathological cyclic strain-induced apoptosis in human periodontal ligament fibroblasts via Rac1/Cdc42. Clin Exp Pharmacol Physiol. 47:1591–1599. 2020. View Article : Google Scholar : PubMed/NCBI

26 

Wu PR, Chiang SY, Midence R, Kao WC, Lai CL, Cheng IC, Chou SJ, Chen CC, Huang CY and Chen RH: Wdr4 promotes cerebellar development and locomotion through Arhgap17-mediated Rac1 activation. Cell Death Dis. 14:522023. View Article : Google Scholar : PubMed/NCBI

27 

Yi C, Troutman S, Fera D, Stemmer-Rachamimov A, Avila JL, Christian N, Persson NL, Shimono A, Speicher DW, Marmorstein R, et al: A tight junction-associated Merlin-angiomotin complex mediates Merlin's regulation of mitogenic signaling and tumor suppressive functions. Cancer Cell. 19:527–540. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Ullah R, Yin Q, Snell AH and Wan L: RAF-MEK-ERK pathway in cancer evolution and treatment. Semin Cancer Biol. 85:123–154. 2022. View Article : Google Scholar : PubMed/NCBI

29 

Tian Q, Gao H, Zhou Y, Zhu L and Yang J, Wang B, Liu P and Yang J: RICH1 inhibits breast cancer stem cell traits through activating kinases cascade of Hippo signaling by competing with Merlin for binding to Amot-p80. Cell Death Dis. 13:712022. View Article : Google Scholar : PubMed/NCBI

30 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Aslan JE: Platelet Rho GTPase regulation in physiology and disease. Platelets. 30:17–22. 2019. View Article : Google Scholar : PubMed/NCBI

32 

Zhang J, Wang J, Zhou YF, Ren XY, Lin MM, Zhang QQ, Wang YH and Li X: Rich1 negatively regulates the epithelial cell cycle, proliferation and adhesion by CDC42/RAC1-PAK1-Erk1/2 pathway. Cell Signal. 27:1703–1712. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Luan Y, Luan Y, Feng Q, Chen X, Ren KD and Yang Y: Emerging role of mitophagy in the heart: Therapeutic potentials to modulate mitophagy in cardiac diseases. Oxid Med Cell Longev. 2021:32599632021. View Article : Google Scholar : PubMed/NCBI

34 

Pan C, Wang S, Liu C and Ren Z: Actin-binding proteins in cardiac hypertrophy. Cells. 11:35662022. View Article : Google Scholar : PubMed/NCBI

35 

Yan ZP, Li JT, Zeng N and Ni GX: Role of extracellular signal-regulated kinase 1/2 signaling underlying cardiac hypertrophy. Cardiol J. 28:473–482. 2021. View Article : Google Scholar : PubMed/NCBI

36 

Zoppino FC, Militello RD, Slavin I, Alvarez C and Colombo MI: Autophagosome formation depends on the small GTPase Rab1 and functional ER exit sites. Traffic. 11:1246–1261. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Sun Y, Xu C, Jiang Z and Jiang X: DEF6(differentially exprehomolog. exacerbates pathological cardiac hypertrophy via RAC1. Cell Death Dis. 14:4832023. View Article : Google Scholar : PubMed/NCBI

38 

Li G, Wang Y, Guo XB and Zhao B: CDC42 regulates cell proliferation and apoptosis in bladder cancer via the IQGAP3-mediated Ras/ERK pathway. Biochem Genet. 60:2383–2398. 2022. View Article : Google Scholar : PubMed/NCBI

39 

Mondaca-Ruff D, Araos P, Yañez CE, Novoa UF, Mora IG, Ocaranza MP and Jalil JE: Hydrochlorothiazide reduces cardiac hypertrophy, fibrosis and rho-kinase activation in DOCA-salt induced hypertension. J Cardiovasc Pharmacol Ther. 26:724–735. 2021. View Article : Google Scholar : PubMed/NCBI

40 

Moradi A, Maroofi A, Hemati M, Hashemzade T, Alborzi N and Safari F: Inhibition of GTPase Rac1 expression by vitamin D mitigates pressure overload-induced cardiac hypertrophy. Int J Cardiol Heart Vasc. 37:1009222021.PubMed/NCBI

41 

Liao JK: Statin therapy for cardiac hypertrophy and heart failure. J Investig Med. 52:248–253. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang S, Wang X, Ling L, Li C and Ren Z: RICH1 is a novel key suppressor of isoproterenol‑ or angiotensin II‑induced cardiomyocyte hypertrophy. Mol Med Rep 29: 69, 2024.
APA
Wang, S., Wang, X., Ling, L., Li, C., & Ren, Z. (2024). RICH1 is a novel key suppressor of isoproterenol‑ or angiotensin II‑induced cardiomyocyte hypertrophy. Molecular Medicine Reports, 29, 69. https://doi.org/10.3892/mmr.2024.13193
MLA
Wang, S., Wang, X., Ling, L., Li, C., Ren, Z."RICH1 is a novel key suppressor of isoproterenol‑ or angiotensin II‑induced cardiomyocyte hypertrophy". Molecular Medicine Reports 29.5 (2024): 69.
Chicago
Wang, S., Wang, X., Ling, L., Li, C., Ren, Z."RICH1 is a novel key suppressor of isoproterenol‑ or angiotensin II‑induced cardiomyocyte hypertrophy". Molecular Medicine Reports 29, no. 5 (2024): 69. https://doi.org/10.3892/mmr.2024.13193
Copy and paste a formatted citation
x
Spandidos Publications style
Wang S, Wang X, Ling L, Li C and Ren Z: RICH1 is a novel key suppressor of isoproterenol‑ or angiotensin II‑induced cardiomyocyte hypertrophy. Mol Med Rep 29: 69, 2024.
APA
Wang, S., Wang, X., Ling, L., Li, C., & Ren, Z. (2024). RICH1 is a novel key suppressor of isoproterenol‑ or angiotensin II‑induced cardiomyocyte hypertrophy. Molecular Medicine Reports, 29, 69. https://doi.org/10.3892/mmr.2024.13193
MLA
Wang, S., Wang, X., Ling, L., Li, C., Ren, Z."RICH1 is a novel key suppressor of isoproterenol‑ or angiotensin II‑induced cardiomyocyte hypertrophy". Molecular Medicine Reports 29.5 (2024): 69.
Chicago
Wang, S., Wang, X., Ling, L., Li, C., Ren, Z."RICH1 is a novel key suppressor of isoproterenol‑ or angiotensin II‑induced cardiomyocyte hypertrophy". Molecular Medicine Reports 29, no. 5 (2024): 69. https://doi.org/10.3892/mmr.2024.13193
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team