Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
May-2014 Volume 31 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2014 Volume 31 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

MicroRNA expression profiles in human breast cancer cells after multifraction and single-dose radiation treatment

  • Authors:
    • Chung-Man Leung
    • Ting-Wen Chen
    • Sung-Chou Li
    • Meng-Ru Ho
    • Ling-Yueh Hu
    • Wen‑Shan Liu
    • Tony T. Wu
    • Ping-Chi Hsu
    • Hong-Tai Chang
    • Kuo-Wang Tsai
  • View Affiliations / Copyright

    Affiliations: Department of Radiation Oncology, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan, R.O.C., Molecular Medicine Research Center, Chang Gung University, Taoyuan, Taiwan, R.O.C., Genomics and Proteomics Core Laboratory, Department of Medical Research, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan, R.O.C., Biodiversity Research Center, Academia Sinica, Taipei, Taiwan, R.O.C., Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan, R.O.C., Department of Surgery, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan, R.O.C., Department of Safety, Health and Environmental Engineering, National Kaohsiung First University of Science and Technology, Kaohsiung, Taiwan, R.O.C., Department of Medical Education and Research, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwan, R.O.C.
  • Pages: 2147-2156
    |
    Published online on: March 13, 2014
       https://doi.org/10.3892/or.2014.3089
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

MicroRNAs (miRNAs) are small non-coding RNAs that contribute to modulating signaling pathways after radiation exposure and have emerged as a potential therapeutic target or biomarker in the radiation response of cancer. Exposing breast cancer cells to single-dose (SD) or multifractionated (MF) radiation may affect the cells differently. However, the roles of miRNAs in breast cancer cells after the response to SD or MF is not thoroughly understood. Therefore, the purpose of the present study was to comprehensively investigate the response of miRNAs in MDA-MB-361 by using various radiation exposing protocols. Our results revealed that only a small fraction of miRNAs exhibiting differential expressions (>1.5‑fold) was identified after MDA-MB-361 cells were exposed to SD (10 Gy) or MF radiation (2 Gy x 5 MF). In addition, we observed that several miRNAs in the MDA-MB-361 cells frequently exhibited differential responses to various types of radiation treatment. Among these miRNAs, the expression levels of an oncogenic miR-17-92 cluster increased following SD radiation treatment. Conversely, miR-19a-3p, miR-20a-5p, and miR-19b-3p expressions were inhibited by >1.5-fold in the following MF treatment. Further analysis of the miR-17-92 cluster expression levels revealed that miR-17, miR-18a, miR-19a/b and miR-20a were significantly overexpressed and miR-92a was downregulated in breast cancer. Functional annotation demonstrated that target genes of the miR-17-92 cluster were predominantly involved in the regulation of radiation-associated signal pathways such as mitogen-activated protein kinase (MAPK), ErbB, p53, Wnt, transforming growth factor-β (TGF-β), mTOR signaling pathways and cell cycles with an FDR <0.05. Overall, the results of the present study revealed distinct differences in the response of miRNAs to SD and MF radiation exposure, and these radiation-associated miRNAs may contribute to radiosensitivity and can be used as biomarkers for radiotherapy.

Introduction

Ionizing radiation, used alone or in combination with surgery and chemotherapy, plays an essential role in the management of breast cancer from the early to advanced stages. More than half of all patients with breast cancer are treated with radiotherapy (1). Ionizing radiation damages cells by using free radicals from the radiolysis of water that cause DNA double-strand breaks. Extensive biological effects are induced in the cells after radiation exposure, including apoptosis and DNA repair (2,3). A complex cell response is elicited to repair radiation damage, including an alteration in gene expression, particularly in genes involved in stress response, cell cycle control and DNA repair (4). Radiation sensitivity varies widely among people, and much of the difference in the effects of radiation exposure is observed at the gene expression level (5). A more comprehensive understanding of the tumor radiation-related genes can be particularly useful for predicting tumor response to radiotherapy and potentially modulating the treatment outcome of breast cancer patients.

Clinically, fractionation is widely used in radiotherapy with multiple 2-Gy fractions over the course of several weeks with total radiation doses of 50–60 Gy. This process allows for sufficient time between dose fractions, it provides treatment benefits involving the further sparing of normal tissue by repairing the sublethal damage, and it increases the damage to the tumor through the reoxygenation and reassortment of cells into radiosensitive phases of the cycle between dose fractions. However, in recent years, radiotherapy involving large fraction size [including stereotactic body radiation therapy (SBRT)] and doses from 5 Gy to 25 Gy per fraction has become a mainstay for treating lung cancer or metastatic tumors to achieve more effective tumor control. Tsai et al (6) determined that, at the molecular level, the patterns of gene expression vary substantially between single-dose (SD) and fractionated radiation in 3 cancer cell lines, which results in the differential expression of 463 genes, of which 13 are commonly upregulated in MCF7, SF539 and DU145 cells. Compared with SD radiation, another study revealed that a more robust induction of genes occurs during fractionated radiation (7).

MicroRNAs (miRNAs) are small RNAs of ~22 nucleotides in length that act as crucial negative regulators of protein expression at the post-transcriptional level (8). These molecules function as inhibitors of target mRNA for either the degradation or inhibition of gene function. Researchers have suggested that miRNAs are responsible for controlling ~50% of all protein-coding genes (9). Studies have indicated that the expression of miRNAs has been clearly involved in cancer development, and the alternation of miRNAs has been observed in various types of cancer, including breast cancer. Iorio et al (10) identified miRNA aberrant expression in human breast cancer by using systematic profiling, and revealed that it is specifically correlated with pathological features of breast cancer, such as estrogen and progesterone receptor expression, tumor stage, vascular invasion and cell proliferation. miRNAs have also been determined to play vital roles in a majority of biological processes in breast cancer, including tumor cell growth, apoptosis, invasion and metastasis. miR-125a suppresses cell growth and induces apoptosis in breast cancer cells by targeting the mRNA encoding the RNA-stabilizing protein HuR (11). In a murine xenograft model study, invasion and metastasis were induced by the overexpression of miR-10b in a breast cancer tumor (12). Among these dysfunctional miRNAs, several have been demonstrated to play a critical role in breast cancer radiosensitivity, including let-7 family miR-7, miR-21, miR-31, miR-200c, miR-199a and miR-302a (13–18). However, these radioresponse miRNA expressions may differ depending on whether cells are exposed to an SD or multifractionated (MF) radiation dose. In the present study, miRNA expression profiles were compared in human MDA-MB-361 cells exposed to an SD or MF radiation dose by using the next-generation sequence approach. The data revealed that differential expression patterns of miRNAs occurred when using 2 distinct radiation protocols. Among these patterns, the response of miR-17-92 cluster expression clearly differed between the SD and MF radiation dose in MDA-MB-361 cells. We further investigated the role of the miR-17-92 cluster in breast cancer by using in silico analysis. We concluded that these radiation-response miRNAs can be used as therapeutic targets for improving the efficacy of radiation treatment in future breast cancer therapy.

Materials and methods

Cell culture and radiation treatment

Breast cancer cells, MDA-MB-361, were obtained from the American Type Culture Collection and were maintained in Dulbecco’s modified Eagle’s medium, supplemented with 10% inactivated fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA). The cells were exposed to various radiation dosages (0, 2, 6, 10, 14 and 18 Gy), and were subsequently cultured in fresh medium. The total RNA was obtained at 15 h following radiation treatment, using TRIzol (Invitrogen) according to the manufacturer’s instructions. The concentration, purity and amount of total RNA were determined using a NanoDrop 1000 spectrophotometer (NanoDrop Technologies Inc., USA).

Clinical breast cancer samples

Breast cancer samples (including 44 breast tumors and 29 adjacent normal tissues) were collected from 44 breast cancer patients who received a surgical operation at the Department of Surgery, Kaohsiung Veterans General Hospital. Informed consent was obtained from all the patients. The total RNA of the tissue was extracted using a TRIzol reagent, according to the instructions.

Collection and preprocessing of sequence reads

The MDA-MB-361 cells were exposed to 10 Gy of radiation, administered either as SD or MF radiation. To administer MF radiation, the cells were exposed to 2 Gy a day for 5 days. After the final dose of radiation treatment was administered, the cells were lysed at 15 h for RNA extraction. The RNA samples were prepared using an Illumina small RNA preparation kit, and were subsequently sequenced using the Illumina HiSeq platform. The generated sequence reads were first subjected to quality control to remove low-quality reads. The sequence reads were then subjected to 3′ adaptor trimming to generate clean reads, as previously described (19,20). To attain a high confidence level, only the clean reads with a read count ≥2 and with a length ranging from 15 to 27 nt were included in further analyses.

Mapping clean reads to pre-miRNAs

To investigate the miRNA expression profiles in various libraries (control, SD and MF radiation), the qualified clean reads were mapped back to human pre-miRNAs (miRBase 19). To eliminate ambiguous multiple hits during the mapping procedure, no mismatch was allowed. Previous studies have reported that, when mapped back to pre-miRNAs, sequence reads typically carry mismatches preferentially located at the terminal 3′ ends (21–24). This mismatch was termed the 3′ end modification. Based on the read count of all the isomiRs belonging to the same mature miRNAs, the miRNA expression levels were evaluated and presented in transcripts per million (TPM).

Stem-loop reverse transcription and real-time polymerase chain reaction

Reverse transcription (RT) primers were specifically designed for examining miRNAs according to the methods used by Chen et al (25). One microgram of total RNA was reverse transcribed in a stem-loop RT reaction, using RT primers and a SuperScript III Reverse Transcriptase according to the user manual (Invitrogen). The reaction was performed under the following incubation conditions: 30 min at 16°C, followed by 50 cycles of 20°C for 30 sec, 42°C for 30 sec and 50°C for 1 sec. The enzyme was subsequently inactivated by incubating it at 85°C for 5 min. Real-time polymerase chain reactions (PCRs) were performed using a miRNA-specific forward primer and a universal reverse primer combined with incubation at 94°C for 10 min, followed by 40 cycles of 94°C for 15 sec and 60°C for 32 sec. The gene expression levels were detected using the SYBR-Green I assay (Applied Biosystems, Foster City, CA, USA), and the miRNA expression levels were normalized to that of U6. The primer sequences for the examined miRNAs are listed as follows: miR-17-RT, CTCAACTG GTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCTGC and miR-17-GSF, CGGCGGCAAAGTGCTTACAGTG; miR-18a-RT, CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTATCTGC and miR-18a-GSF, CGGCGGTAAGGTGCATCTAGTG; miR-19a-RT, CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAGTTTT and miR19a-GSF, CGGCGGTGTGCAAATCCATGCA; miR-19b-RT, CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAGTTTT and miR-19b-GSF, CGGCGGTGTGCAAATCCATGCA; miR-20a-RT, CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCTGC and miR-20a-GSF, CGGCGGTAAAGTGCTTATAGTG; miR-92a-RT, CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAGGCCG and miR-92a-GSF, CGGCGGTATTGCACTTGTCCCG.

miRNA expression level according to The Cancer Genome Atlas data

Members of The Cancer Genome Atlas (TCGA) project collect both cancer and corresponding normal tissues from hundreds of breast cancer patients. All the level-3 miRNA expression data for breast cancer were downloaded from the TCGA data portal (https://tcga-data.nci.nih.gov/tcga/dataAccessMatrix.htm). These level-3 data included calculated expressions for each miRNA derived from the next-generation sequencing results. In addition, the expression profiles of miRNAs observed in the tumor and corresponding normal samples of 102 patients were downloaded. The normalized quantification expression levels for these 102 participants were further examined for each investigated miRNA.

Pathway enrichment analysis

The target genes of miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a were downloaded from TargetScan 6.0, and were then mapped onto the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways based on the Enzyme Commission (EC) numbers by using the R package SubPathwayMiner v.3.1 software (26). Subsequently, a hypergeometric test was performed to identify significantly enriched pathways and to calculate the false positive discovery rate in the FDR-corrected q-value.

Results

miRNA profiling of radiation-treated breast cancer cells

By using the next-generation sequencing approach, we comprehensively analyzed the distribution of miRNAs in MDA-MB-361 cells after administering SD and MF radiation at 10 Gy. As shown in Table I, we obtained >8 million clean reads in 3 libraries. By summarizing the read count of all the isomiRs belonging to the same mature miRNAs, we quantified the miRNA expression abundances, presented in TPM. After mapping the clean reads to the genome, >500 miRNAs expressed in the MDA-MB-361 cells (TPM >1) were detected. Most of these miRNAs were consistently expressed between the control group and the group that received radiation treatment with SD or MF radiation (R2 >0.8; Fig. 1A). Only a small fraction of the miRNAs were identified as being differentially expressed (>1.5-fold) after the MDA-MB-361 cells were exposed to a 10-Gy SD and 2-Gy × 5 fractionated radiation. Comparing the control cells revealed that 13 and 31 miRNAs were upregulated and downregulated, respectively, after undergoing 2-Gy × 5 fractionated radiations. In addition, 52 and 20 miRNAs were upregulated and downregulated, respectively, after undergoing 10-Gy SD radiation (Fig. 1B). Tables II and III list the top 20 upregulated and top 20 downregulated miRNAs after undergoing MF or SD radiation.

Figure 1

Comparison of miRNA expression profiles in MDA-MB-361 breast cancer cells subjected to single- and multifractionated-dose radiation. MDA-MB-361 cells were treated either with or without SD (10 Gy) or MF (5 × 2 Gy) radiation and were subsequently subjected to fresh culture medium. After culturing the samples for an additional 15 h, the miRNA profiles were obtained using next-generation sequencing. (A) Scatter plot of miRNA distribution; SD vs control treatment (top); MF vs. control group (middle) and SD vs. MF (bottom). (B) Venn diagrams depicting the number of upregulated and downregulated miRNAs in MDA-MB-361 after exposure to 10-Gy SD and MF radiation. SD, single-dose; MF, multifractionated.

Table I

Summary of sequences reads information in three libraries.

Table I

Summary of sequences reads information in three libraries.

Sample nameTotal Illumina readsClean read, R >=2Percentage (%)Detected miRs
Control11,229,1608,741,81777.85510
MF11,086,4728,780,48279.20637
SD11,685,1858,982,54576.87626

[i] We mapped the clean reads back to human pre-miRNAs according to miR-Base 19. MF, multifractionated; SD, single-dose.

Table II

MicroRNAs differentially expressed between control and multi-fractionated radiation.

Table II

MicroRNAs differentially expressed between control and multi-fractionated radiation.

UpregulationControl (RPM)MF (RPM)MF/control
hsa-let-7e-5p2113.15788.12.739151
hsa-let-7a-5p12845.334454.32.68225
hsa-miR-423-5p2644.17037.12.661435
hsa-let-7f-5p47084.295634.22.031131
hsa-let-7d-5p1791.13516.11.963095
hsa-miR-32-5p35.166.11.883191
hsa-miR-744-5p500.1933.11.865827
hsa-miR-181c-5p191.1319.11.669806
hsa-miR-16-5p10650.216872.21.584214
hsa-miR-424-3p182.1285.11.565623
hsa-miR-126-3p71.1109.11.534459
hsa-miR-128984.21473.21.49685
hsa-miR-361-3p85.1127.11.493537
hsa-miR-320b484.2720.21.487402
hsa-miR-877-5p393.1584.11.485881
hsa-miR-574-5p85.1125.11.470035
hsa-miR-151b64.192.11.436817
hsa-miR-218-5p103.2148.21.436047
hsa-miR-10a-5p3512.15020.11.429373
hsa-miR-92b-3p5372.17672.11.428138
Downregulation
hsa-miR-1296406.1110.10.271115
hsa-let-7f-1-3p37.112.10.326146
hsa-let-7a-3p92.232.20.349241
hsa-miR-452174.131.10.419703
hsa-miR-19a-3p901.1382.10.424037
hsa-miR-1246108.147.10.435708
hsa-miR-19b-3p1829.2855.20.467527
hsa-miR-428663.130.10.477021
hsa-miR-149-5p107.151.10.477124
hsa-miR-30a-5p201261.1105788.10.525626
hsa-miR-221-3p28915.116665.10.576346
hsa-miR-445464.137.10.578783
hsa-miR-143-3p61.136.10.590835
hsa-miR-20a-5p644.1388.10.602546
hsa-miR-339-5p158.1105.10.664769
hsa-miR-598135.191.10.674315
hsa-miR-660-5p320.1218.10.68135
hsa-miR-181b-3p91.162.10.681668
hsa-miR-374b-5p60.141.10.68386
hsa-miR-561-5p203.1140.10.689808

[i] MF, multifractionated.

Table III

MicroRNAs differentially expressed between control and single-dose radiation.

Table III

MicroRNAs differentially expressed between control and single-dose radiation.

UpregulationControl (RPM)SD (RPM)SD/control
hsa-miR-19b-3p1829.210280.25.620052
hsa-miR-19a-3p901.12663.12.955388
hsa-miR-374a-5p88.1225.12.555051
hsa-miR-1285-3p118.2267.22.260575
hsa-miR-1296406.1867.12.135188
hsa-miR-374b-5p60.1128.12.131448
hsa-miR-454-3p242.1511.12.111111
hsa-miR-210281.1577.12.053006
hsa-miR-424-5p104.1213.12.04707
hsa-let-7a-3p92.2186.22.019523
hsa-miR-769-5p527.11029.11.952381
hsa-miR-30c-5p6496.212008.21.848496
hsa-miR-101-3p1258.22322.21.845653
hsa-miR-10a-5p3512.16375.11.815182
hsa-miR-96-5p69.1125.11.81042
hsa-miR-428663.1114.11.808241
hsa-miR-221-3p28915.151925.11.795778
hsa-miR-625-3p33.159.11.785498
hsa-miR-20a-5p644.11144.11.776277
hsa-miR-126-5p316.1561.11.775071
Downregulation
hsa-miR-423-5p2644.1847.10.320374
hsa-let-7f-5p47084.221041.20.446885
hsa-miR-138-1-3p218.1100.10.458964
hsa-miR-222-5p273.1147.10.538631
hsa-miR-143-3p61.134.10.558101
hsa-miR-744-5p500.1288.10.576085
hsa-miR-92a-1-5p154.194.10.610642
hsa-miR-18a-3p138.185.10.61622
hsa-miR-30a-5p201261.1124649.10.61934
hsa-miR-877-5p393.1253.10.643857
hsa-miR-423-3p4484.12966.10.661471
hsa-miR-339-3p234.1156.10.666809
hsa-let-7d-5p1791.11195.10.667244
hsa-miR-30d-5p12115.18090.10.66777
hsa-miR-1246108.173.10.676226
hsa-miR-25-5p271.1185.10.682774
hsa-miR-1275157.1109.10.694462
hsa-miR-92b-3p5372.13880.10.722269
hsa-miR-224-5p190.1141.10.742241
hsa-miR-484374.1279.10.746057

[i] SD, single-dose.

SD and MF radiation induces dissimilar miRNA responses in MDA-MB-361

Although most of the miRNA expression was consistent after MF and SD radiation treatment (R2=0.8285; Fig. 1A), we observed that several radiation-induced miRNA responses were dissimilar between those treated with either SD or MF radiation. In the present study, we revealed that using various radiation exposure methods caused 8 common miRNAs in MDA-MB-361 cells to change >1.5-fold under MF and SD radiation, including the upregulation of 4 miRNAs: miR-32-3p, miR-126-5p, miR-181c-5p and miR-424-5p, and the downregulation of 4 miRNAs: miR-30a-5p, miR-143-3p, miR-339-3p and miR-1246. In addition, the converse response of these miRNAs was frequently observed in the cells that underwent either MF or SD radiation treatment in the present study. The levels of 4 miRNA expressions increased after MF radiation, but after SD radiation, these miRNA expression levels decreased (let-7f-5p, let-7d-5p, miR-423-5p and miR-744-5p). In addition, 16 miRNA expressions were inhibited in 2-Gy MF radiation-treated MDA-MB-361 cells, but were activated following 10-Gy SD radiation treatment.

Radiation-induced miR-17-92 cluster expression

According to the NGS data, we identified several radiation-induced miRNAs and observed that several miRNAs exhibited differential responses to various radiation treatment methods. Among these miRNAs, we observed that the expression levels of miR-19a, miR-20a and miR-19b clearly increased in the MDA-MB-361 cells after undergoing 10-Gy SD radiation treatment (Table II). These miRNAs were located at chromosome 13 and belonged to the miR-17-92 cluster, which has been determined to play an oncogenic role in tumorigenesis by regulating cell survival, proliferation, differentiation and cell cycles (27–29). The miR-17-92 cluster was embedded with 6 miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b and miR-92a (Fig. 2A). As shown in Fig. 2B, the expression levels of most of the miRNAs in the miR-17-92 cluster increased after undergoing SD radiation treatment. Conversely, the miR-19a-3p, miR-20a-5p and miR-19b-3p expressions were inhibited >1.5-fold in the MDA-MB-361 cells following MF treatment (Fig. 2B). We further examined the expression levels of the miR-17-92 cluster (only the major arm of the miRNAs was selected) in the MDA-MB-361 cells following treatment with various doses of radiation for 15 h, using the real-time PCR approach. As shown in Fig. 2C, the expression levels of the miRNAs in the miR-17-92 cluster gradually increased in a dose-dependent manner (0, 2, 6, 10, 14 and 18 Gy). These results indicated that, except for miR-92a, miR-17-92 cluster expression can be activated by radiation treatment in MDA-MB-361 cells.

Figure 2

Radiation-induced expression levels of miR-17-92 in breast cancer cells, MDA-MB-361. (A) Schematic displays of the structure and location of the miR-17-92 cluster. (B) Fold changes of the 5p/3p arm of the miR-17-92 cluster after SD and MF radiation treatment were observed using the NGS data. (C) The expression pattern of the miR-17-92 cluster was induced at various radiation treatment doses (0, 2, 4, 6, 8, 10, 12, 14, 16 and 18 Gy) in the MDA-MB-361 cells. SD, single-dose; MF, multifractionated.

Analysis of the role of the miR-17-92 cluster in breast cancer by using an in silico approach

Generally, one miRNA typically contains hundreds of target genes and slightly suppresses its own target gene; therefore, conducting a biological function by using a group of miRNAs comodulated with the same signaling pathway may be more efficient. According to this theory, we further examined the miR-17-92 cluster function by using pathway enrichment analysis. We first obtained the putative target genes of a miR-17-92 cluster from TargetScan 6.0; subsequently, these target genes were mapped onto KEGG pathways. The data indicated that the target genes of the miR-17-92 cluster were frequently and significantly enriched in several cancer-related and radiation-related pathways, including the mitogen-activated protein kinase (MAPK), ErbB, p53, Wnt, transforming growth factor-β (TGF-β) and mTOR signaling pathways, and cell cycle with an FDR <0.05 (Table IV; Fig. 3). These data indicated that the miR-17-92 cluster participated in cancer cell progression and played a crucial role in radiation therapy by regulating radiation-response pathways.

Figure 3

The enriched pathway of the target gene union of the miR-17-92 cluster. (A) The target gene union of the miR-17-92 cluster (miR-17, miR-18a, miR-19a/b, miR-20a and miR-92a) enriched in the MAPK pathway (FDR=1.1E-8). The target genes are labeled in red.

Table IV

Predicted targets of miR-17-92 cluster involved in radiation-relative pathways.

Table IV

Predicted targets of miR-17-92 cluster involved in radiation-relative pathways.

PathwayAnnMolecule ratioAnnBg ratioFDR
Endocytosis67/2785203/217961.21E-11
MAPK signaling pathwaya73/2785266/217961.10E-08
Axon guidance42/2785126/217961.38E-07
Pathways in cancera78/2785322/217966.70E-07
mTOR signaling pathwaya22/278552/217965.06E-06
Neurotrophin signaling pathway37/2785126/217962.37E-05
Regulation of actin cytoskeleton51/2785211/217960.000122
Melanogenesis30/2785100/217960.000122
Focal adhesion48/2785199/217960.000188
GnRH signaling pathway29/278598/217960.000188
Glioma22/278565/217960.000196
Long-term potentiation23/278570/217960.000199
Dilated cardiomyopathy26/278585/217960.000217
Melanoma23/278571/217960.000222
Chronic myeloid leukemia23/278572/217960.000268
Wnt signaling pathwaya38/2785150/217960.000285
Renal cell carcinoma22/278568/217960.000285
Progesterone-mediated oocyte maturation26/278588/217960.000309
Pancreatic cancer22/278570/217960.000423
Calcium signaling pathway42/2785177/217960.000487
Phosphatidylinositol signaling systema23/278578/217960.000787
Oocyte meiosis29/2785111/217960.001083
Salivary secretion24/278586/217960.00132
TGF-β signaling pathwaya23/278582/217960.001591
Prostate cancer24/278588/217960.001777
Small cell lung cancer23/278583/217960.001777
Hypertrophic cardiomyopathy (HCM)22/278578/217960.001777
Bladder cancer14/278540/217960.002097
Adipocytokine signaling pathway19/278565/217960.002643
ErbB signaling pathwaya23/278586/217960.002728
Insulin signaling pathway32/2785136/217960.002821
Ubiquitin mediated proteolysis32/2785137/217960.003136
Non-small cell lung cancer16/278554/217960.005639
Circadian rhythm-mammal9/278522/217960.005986
Gastric acid secretion19/278572/217960.00868
p53 signaling pathwaya18/278567/217960.008943
Acute myeloid leukemia16/278557/217960.009507
Colorectal cancer17/278563/217960.010764
Cell cyclea28/2785127/217960.014135
Vasopressin-regulated water reabsorption13/278544/217960.014273
Dorso-ventral axis formation9/278526/217960.019367
Inositol phosphate metabolism15/278557/217960.022744
Vascular smooth muscle contraction25/2785114/217960.022744
Aldosterone-regulated sodium reabsorption12/278542/217960.025281
Fc ɛ RI signaling pathway18/278575/217960.026074
Hepatitis C28/2785134/217960.026074
Amyotrophic lateral sclerosis (ALS)14/278553/217960.026074
Fc γ R-mediated phagocytosis20/278587/217960.027332
Arrhythmogenic right ventricular cardiomyopathy (ARVC)17/278571/217960.031624
Chemokine signaling pathway36/2785187/217960.032834
Glycosphingolipid biosynthesis-ganglio series6/278515/217960.03323
ECM-receptor interaction19/278584/217960.036636
Hedgehog signaling pathway14/278556/217960.038697

a Radiation-associated signaling pathways.

To further elucidate the role of the miR-17-92 cluster in breast cancer, we analyzed the expression levels of a miR-17-92 cluster in breast cancer, which were provided by the TCGA dataset, using in silico analysis. We downloaded 204 miRNA expression profiles characterizing 102 breast cancer patients. These profiles included breast cancer lesions and the corresponding normal tissues. As shown in Fig. 4A, the expression levels of miR-17, miR-18a, miR-19a, miR-20a and miR-19b were significantly upregulated in the breast cancer cells compared with those of the corresponding normal tissue cells. miR-92a expression was significantly decreased in the breast cancer cells compared with that of the corresponding adjacent cells. We also further examined the expression levels of miR-19a, miR-19b, miR-20a and miR-92a by using real-time PCR in the breast cancer cells. These results were consistent with the TCGA data, indicating that miR-19a and miR-19b expression is significantly upregulated and miR-92a is downregulated in breast cancer cells compared with that of adjacent normal tissues (Fig. 4B). Collectively, the data indicated that expression levels of the miR-17-92 cluster were deregulated in breast cancer cells, suggesting that the miR-17-92 cluster plays a vital role in breast cancer progression.

Figure 4

Expression levels of the miR-17-92 cluster in breast cancer cells. Comparison of the miRNA expression levels between the tumor and corresponding normal tissues obtained from 102 breast cancer patients, which were analyzed using the TCGA dataset. The expression levels of the miRNAs were presented in transcripts per million (TPM). (B) The expression levels of miR-19a/b, miR-20a and miR-92a in clinical breast cancer samples were analyzed using quantitative stem-loop PCR with U6 as an internal control. All the samples were assessed in triplicate and analyzed using the Student’s t-test (P<0.05 was considered significant).

Discussion

miRNAs modulate gene expression by degrading mRNA and inhibiting protein translation, and thereby contribute to the regulation of numerous cancer-relevant cellular phenotypes, including cell proliferation, apoptosis, cell cycle, cell motility and stress response (30,31). Moreover, dysfunctional miRNAs are involved in breast cancer carcinogenesis through the impairment of cancer-related pathways (32). Understanding the functions of miRNAs may contribute to cancer diagnosis, prognosis and therapy (33,34). Previous studies have indicated that several miRNAs can serve as biomarkers for the diagnosis and prognosis of breast cancer (35). In a previous study, the expression of miR-210 was determined to be associated with the clinical prognosis of breast cancer. The upregulation of miR-210 was reported to contribute to decreased rates of disease-free and overall survival (36). Kovalchuk et al (37) revealed that miR-451 is correlated with the expression of multidrug resistant genes and that drug sensitivity to doxorubicin-resistant breast cancer could be enhanced by restoring miR-451 into the cell. Thus, correcting the altered expression of miRNA by restoring miR-451 can also be used as a strategy to improve responsiveness to chemotherapy. In addition, miRNAs were observed to exhibit high stability in human serum and plasma (38). One recent study demonstrated that a decrease in the levels of miR-92a and an increase in the levels of miR-21 were consistent and specific in the serum of breast cancer patients, and suggested that miRNA can be used as biomarkers for early breast cancer detection in the future (39).

Radiation-induced DNA damage initiates cellular responses, such as cell cycle arrest, DNA damage repair and apoptosis (40). Previous studies have revealed that miRNAs also act as potential agents for predicting radiation responses or are used to modulate tumor radiation response to cancer cells further, thus enhancing the efficacy of radiation therapy against resistant cancers (34,35,40). In breast cancer, several miRNAs have been identified as critical in influencing the radiosensitivity of breast cancer during radiation therapy, including let-7 family miR-7, miR-21, miR-31, miR-200c, miR-199a and miR-302a (13–18). Among the miRNAs identified as potential agents that contribute to radiation responsiveness, let-7 family was one of the first miRNAs to be investigated. A previous study revealed that let-7a overexpression can suppress the expression of K-Ras and radiosensitize lung cancer cells (41). Another study determined that the ectopic overexpression of miR-7 enhanced EGFR and Akt expression and radiosensitized laryngeal, breast and lung cancer cell (14). In addition, a recent study demonstrated that miR-21 expression in breast cancer cells contributes to radiation resistance by inhibiting the G2/M check point (16). The upregulation of miR-302a sensitizes radioresistant breast cancer cells and reduces the expression of AKT1 and RAD52 (42). Furthermore, miR-199a-5p suppresses radiation-induced autophagy, and inhibits DRAM1 and Beclin1 expression in breast cancer cells (17).

The miR-17-92 cluster is an oncogenic miRNA that regulates cell survival, proliferation, differentiation and angiogenesis in most human types of cancer, including breast cancer (43–45). Previous studies revealed that the overexpression of miR-17-92 in human cancer cells markedly decreases the radiosensitivity of these cells through the repression of PTEN and PHLPP2, which causes the activation of the PI3K/AKT pathway to become enhanced (46). In the present study, the data revealed that the numerous miRNA responses differed between the cells that underwent either SD or MF radiation. Among the miRNAs, we observed that the expressions of the miR-17-92 cluster were upregulated under SD radiation treatment. Conversely, these expressions were frequently inhibited following MF radiation treatment (Fig. 2B). Tsai et al (6) reported that the survival rate of breast cancer cells following MF (5 × 2 Gy) was higher than that following SD, which was expected since sublethal damage was repaired between fractions. Exposing the breast cancer cells to SD at 10 Gy led to the predominant entry of these cells into the cell death pathway. The observation that the cells were affected differently following SD and MF radiation treatment could explain why miRNA expressions frequently vary based on the treatment method used. John-Aryankalayil et al (20) also demonstrated the differential expression patterns of several miRNAs, including miR-17-92 cluster, miR-34a, let-7 family miRNAs and has-miR-146a, in 3 prostate cancer cell lines after undergoing SD and fractionated radiation. Their results revealed that the miR-17-92 cluster is markedly downregulated by radiation treatment in p53-positive prostate cells. Following radiation treatment, increasing wild-type p53 expression causes cells to accumulate in the G1 phase (47). The status of p53 was demonstrated to significantly influence the expression profile of genes following fractionated irradiation (48). Since a mutated p53 gene cell line, MDA-MB-361, was used in the present study, p53-regulated genes should not be induced in MDA-MB-361 cells following radiation treatment. The elevated expression levels of a miR-17-92 cluster in MDA-MB-361 cells undergoing radiation treatment should be p53-independent pathway. Yan et al (49) reported that the miR-17-92 cluster is a novel target for p53-mediated transcriptional repression. The transcription factors, c-Myc and E2F family, have been observed to directly bind to the promoter of the miR-17-92 cluster and increase the transcriptional activity of the cluster (50–52). Previous studies have reported that expression levels of c-Myc and E2F can be induced in breast cancer cells following radiation treatment (53–55). According to these studies, cells with wild-type p53 cause the expression levels of the miR-17-92 cluster to decrease through radiation-induced p53 activity. Conversely, an increase in miR-17-92 transcriptional activity results from c-Myc or E2F expression levels in mutated p53 cells undergoing radiation treatment.

In the present study, we identified several radiation-associated miRNAs that were clearly altered under either SD or MF radiation treatment, including let-7 family, miR-138 and the miR-17-92 cluster (>2-fold changes; Tables II and III). Wang et al (13) demonstrated that overexpression of Let-7 enhanced the sensitivity of breast cancer cells to radiation. In addition, miR-138 expression increased under SD treatment. However, overexpression of miR-138 inhibited homologous recombination and enhanced the sensitivity of osteosarcoma cells to multiple DNA-damaging agents including radiation (56). Niemoeller et al (57) identified the expression levels of numerous miRNAs known to be involved in the regulation of cellular processes such as apoptosis, proliferation, invasion, local immune response and radioresistance. These miRNAs, including let-7, miR-138 and miR-1285, displayed 2–3-fold changes after undergoing irradiation. Moreover, several miRNAs previously not known to be radiation responsive were determined in the present study, including miR-149, miR-374a/b, miR-423, miR-424, miR-454, miR-1246 and miR-1296. These miRNA candidates can serve as effective targets for improving the efficacy of radiation treatment in future breast cancer therapy.

Acknowledgements

This study was supported by grants from the Kaohsiung Veterans General Hospital (VGHKS 103-G01-3 and VGHKS 103-043). The authors would like to thank Genomics and Proteomics Core Laboratory, Department of Medical Research, Kaohsiung Chang Gung Memorial Hospital, for the help with NGS data analysis.

References

1 

Delaney G, Jacob S, Featherstone C and Barton M: The role of radiotherapy in cancer treatment: estimating optimal utilization from a review of evidence-based clinical guidelines. Cancer. 104:1129–1137. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Rzeszowska-Wolny J, Przybyszewski WM and Widel M: Ionizing radiation-induced bystander effects, potential targets for modulation of radiotherapy. Eur J Pharmacol. 625:156–164. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Runkle EA, Zhang H, Cai Z, et al: Reversion of the ErbB malignant phenotype and the DNA damage response. Exp Mol Pathol. 93:324–333. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Yin E, Nelson DO, Coleman MA, Peterson LE and Wyrobek AJ: Gene expression changes in mouse brain after exposure to low-dose ionizing radiation. Int J Radiat Biol. 79:759–775. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Correa CR and Cheung VG: Genetic variation in radiation-induced expression phenotypes. Am J Hum Genet. 75:885–890. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Tsai MH, Cook JA, Chandramouli GV, et al: Gene expression profiling of breast, prostate, and glioma cells following single versus fractionated doses of radiation. Cancer Res. 67:3845–3852. 2007. View Article : Google Scholar : PubMed/NCBI

7 

John-Aryankalayil M, Palayoor ST, Cerna D, et al: Fractionated radiation therapy can induce a molecular profile for therapeutic targeting. Radiat Res. 174:446–458. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Krol J, Loedige I and Filipowicz W: The widespread regulation of microRNA biogenesis, function and decay. Nat Rev Genet. 11:597–610. 2010.PubMed/NCBI

10 

Iorio MV, Ferracin M, Liu CG, et al: MicroRNA gene expression deregulation in human breast cancer. Cancer Res. 65:7065–7070. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Guo X, Wu Y and Hartley RS: MicroRNA-125a represses cell growth by targeting HuR in breast cancer. RNA Biol. 6:575–583. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Ma L, Teruya-Feldstein J and Weinberg RA: Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Nature. 449:682–688. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Wang L, Yuan C, Lv K, et al: Lin28 mediates radiation resistance of breast cancer cells via regulation of caspase, H2A.X and Let-7 signaling. PLoS One. 8:e673732013. View Article : Google Scholar : PubMed/NCBI

14 

Lee KM, Choi EJ and Kim IA: microRNA-7 increases radiosensitivity of human cancer cells with activated EGFR-associated signaling. Radiother Oncol. 101:171–176. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Lin J, Liu C, Gao F, et al: miR-200c enhances radiosensitivity of human breast cancer cells. J Cell Biochem. 114:606–615. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Anastasov N, Höfig I, Vasconcellos IG, et al: Radiation resistance due to high expression of miR-21 and G2/M checkpoint arrest in breast cancer cells. Radiat Oncol. 7:2062012. View Article : Google Scholar : PubMed/NCBI

17 

Yi H, Liang B, Jia J, et al: Differential roles of miR-199a-5p in radiation-induced autophagy in breast cancer cells. FEBS Lett. 587:436–443. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Körner C, Keklikoglou I, Bender C, Wörner A, Münstermann E and Wiemann S: MicroRNA-31 sensitizes human breast cells to apoptosis by direct targeting of protein kinase C ɛ (PKCɛ). J Biol Chem. 288:8750–8761. 2013.PubMed/NCBI

19 

Cloonan N, Wani S, Xu Q, et al: MicroRNAs and their isomiRs function cooperatively to target common biological pathways. Genome Biol. 12:R1262011. View Article : Google Scholar : PubMed/NCBI

20 

John-Aryankalayil M, Palayoor ST, Makinde AY, et al: Fractionated radiation alters oncomir and tumor suppressor miRNAs in human prostate cancer cells. Radiat Res. 178:105–117. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Ebhardt HA, Tsang HH, Dai DC, Liu Y, Bostan B and Fahlman RP: Meta-analysis of small RNA-sequencing errors reveals ubiquitous post-transcriptional RNA modifications. Nucleic Acids Res. 37:2461–2470. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Landgraf P, Rusu M, Sheridan R, et al: A mammalian microRNA expression atlas based on small RNA library sequencing. Cell. 129:1401–1414. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Reid JG, Nagaraja AK, Lynn FC, et al: Mouse let-7 miRNA populations exhibit RNA editing that is constrained in the 5′-seed/ cleavage/anchor regions and stabilize predicted mmu-let-7a:mRNA duplexes. Genome Res. 18:1571–1581. 2008.PubMed/NCBI

24 

Morin RD, O’Connor MD, Griffith M, et al: Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. Genome Res. 18:610–621. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Chen C, Ridzon DA, Broomer AJ, et al: Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33:e1792005. View Article : Google Scholar : PubMed/NCBI

26 

Li C, Li X, Miao Y, et al: SubpathwayMiner: a software package for flexible identification of pathways. Nucleic Acids Res. 37:e1312009. View Article : Google Scholar : PubMed/NCBI

27 

He L, Thomson JM, Hemann MT, et al: A microRNA polycistron as a potential human oncogene. Nature. 435:828–833. 2005. View Article : Google Scholar : PubMed/NCBI

28 

Hayashita Y, Osada H, Tatematsu Y, et al: A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation. Cancer Res. 65:9628–9632. 2005.PubMed/NCBI

29 

Cho WC: OncomiRs: the discovery and progress of microRNAs in cancers. Mol Cancer. 6:602007. View Article : Google Scholar : PubMed/NCBI

30 

Pan HW, Li SC and Tsai KW: MicroRNA dysregulation in gastric cancer. Curr Pharm Des. 19:1273–1284. 2013.PubMed/NCBI

31 

Zhao L, Bode AM, Cao Y and Dong Z: Regulatory mechanisms and clinical perspectives of miRNA in tumor radiosensitivity. Carcinogenesis. 33:2220–2227. 2012. View Article : Google Scholar : PubMed/NCBI

32 

Chang HT, Li SC, Ho MR, et al: Comprehensive analysis of microRNAs in breast cancer. BMC Genomics. 13(Suppl 7): S182012.PubMed/NCBI

33 

Ferracin M, Querzoli P, Calin GA and Negrini M: MicroRNAs: toward the clinic for breast cancer patients. Semin Oncol. 38:764–775. 2011. View Article : Google Scholar : PubMed/NCBI

34 

Ng EK, Wong CL, Ma ES and Kwong A: MicroRNAs as new players for diagnosis, prognosis, and therapeutic targets in breast cancer. J Oncol. 2009:3054202009.PubMed/NCBI

35 

Iorio MV, Casalini P, Piovan C, Braccioli L and Tagliabue E: Breast cancer and microRNAs: therapeutic impact. Breast. 20(Suppl 3): S63–S70. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Camps C, Buffa FM, Colella S, et al: hsa-miR-210 is induced by hypoxia and is an independent prognostic factor in breast cancer. Clin Cancer Res. 14:1340–1348. 2008. View Article : Google Scholar : PubMed/NCBI

37 

Kovalchuk O, Filkowski J, Meservy J, et al: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 7:2152–2159. 2008. View Article : Google Scholar : PubMed/NCBI

38 

Mitchell PS, Parkin RK, Kroh EM, et al: Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci USA. 105:10513–10518. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Si H, Sun X, Chen Y, et al: Circulating microRNA-92a and microRNA-21 as novel minimally invasive biomarkers for primary breast cancer. J Cancer Res Clin Oncol. 139:223–229. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Zhao L, Lu X and Cao Y: MicroRNA and signal transduction pathways in tumor radiation response. Cell Signal. 25:1625–1634. 2013. View Article : Google Scholar : PubMed/NCBI

41 

Weidhaas JB, Babar I, Nallur SM, et al: MicroRNAs as potential agents to alter resistance to cytotoxic anticancer therapy. Cancer Res. 67:11111–11116. 2007. View Article : Google Scholar : PubMed/NCBI

42 

Liang Z, Ahn J, Guo D, Votaw JR and Shim H: MicroRNA-302 replacement therapy sensitizes breast cancer cells to ionizing radiation. Pharm Res. 30:1008–1016. 2013. View Article : Google Scholar : PubMed/NCBI

43 

de Rinaldis E, Gazinska P, Mera A, et al: Integrated genomic analysis of triple-negative breast cancers reveals novel microRNAs associated with clinical and molecular phenotypes and sheds light on the pathways they control. BMC Genomics. 14:6432013.

44 

Kim K, Chadalapaka G, Lee SO, et al: Identification of oncogenic microRNA-17-92/ZBTB4/specificity protein axis in breast cancer. Oncogene. 31:1034–1044. 2012. View Article : Google Scholar : PubMed/NCBI

45 

Li H, Bian C, Liao L, Li J and Zhao RC: miR-17-5p promotes human breast cancer cell migration and invasion through suppression of HBP1. Breast Cancer Res Treat. 126:565–575. 2011. View Article : Google Scholar : PubMed/NCBI

46 

Jiang P, Rao EY, Meng N, Zhao Y and Wang JJ: MicroRNA-17-92 significantly enhances radioresistance in human mantle cell lymphoma cells. Radiat Oncol. 5:1002010. View Article : Google Scholar : PubMed/NCBI

47 

Kuerbitz SJ, Plunkett BS, Walsh WV and Kastan MB: Wild-type p53 is a cell cycle checkpoint determinant following irradiation. Proc Natl Acad Sci USA. 89:7491–7495. 1992. View Article : Google Scholar : PubMed/NCBI

48 

Simone CB II, John-Aryankalayil M, Palayoor ST, et al: mRNA expression profiles for prostate cancer following fractionated irradiation are influenced by p53 status. Transl Oncol. 6:573–585. 2013. View Article : Google Scholar : PubMed/NCBI

49 

Yan HL, Xue G, Mei Q, et al: Repression of the miR-17-92 cluster by p53 has an important function in hypoxia-induced apoptosis. EMBO J. 28:2719–2732. 2009.

50 

Thomas M, Lange-Grunweller K, Hartmann D, et al: Analysis of transcriptional regulation of the human miR-17-92 cluster; evidence for involvement of Pim-1. Int J Mol Sci. 14:12273–12296. 2013. View Article : Google Scholar : PubMed/NCBI

51 

Li Y, Li Y, Zhang H and Chen Y: MicroRNA-mediated positive feedback loop and optimized bistable switch in a cancer network involving miR-17-92. PLoS One. 6:e263022011. View Article : Google Scholar : PubMed/NCBI

52 

Aguda BD, Kim Y, Piper-Hunter MG, Friedman A and Marsh CB: MicroRNA regulation of a cancer network: consequences of the feedback loops involving miR-17-92, E2F, and Myc. Proc Natl Acad Sci USA. 105:19678–19683. 2008. View Article : Google Scholar : PubMed/NCBI

53 

Papanikolaou V, Iliopoulos D, Dimou I, et al: Survivin regulation by HER2 through NF-κB and c-myc in irradiated breast cancer cells. J Cell Mol Med. 15:1542–1550. 2011.

54 

Orr MS, Watson NC, Sundaram S, Randolph JK, Jain PT and Gewirtz DA: Ionizing radiation and teniposide increase p21waf1/cip1 and promote Rb dephosphorylation but fail to suppress E2F activity in MCF-7 breast tumor cells. Mol Pharmacol. 52:373–379. 1997.PubMed/NCBI

55 

Calaf GM and Hei TK: Ionizing radiation induces alterations in cellular proliferation and c-myc, c-jun and c-fos protein expression in breast epithelial cells. Int J Oncol. 25:1859–1866. 2004.PubMed/NCBI

56 

Wang Y, Huang JW, Li M, et al: MicroRNA-138 modulates DNA damage response by repressing histone H2AX expression. Mol Cancer Res. 9:1100–1111. 2011. View Article : Google Scholar : PubMed/NCBI

57 

Niemoeller OM, Niyazi M, Corradini S, et al: MicroRNA expression profiles in human cancer cells after ionizing radiation. Radiat Oncol. 6:292011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Leung C, Chen T, Li S, Ho M, Hu L, Liu WS, Wu TT, Hsu P, Chang H, Tsai K, Tsai K, et al: MicroRNA expression profiles in human breast cancer cells after multifraction and single-dose radiation treatment. Oncol Rep 31: 2147-2156, 2014.
APA
Leung, C., Chen, T., Li, S., Ho, M., Hu, L., Liu, W. ... Tsai, K. (2014). MicroRNA expression profiles in human breast cancer cells after multifraction and single-dose radiation treatment. Oncology Reports, 31, 2147-2156. https://doi.org/10.3892/or.2014.3089
MLA
Leung, C., Chen, T., Li, S., Ho, M., Hu, L., Liu, W., Wu, T. T., Hsu, P., Chang, H., Tsai, K."MicroRNA expression profiles in human breast cancer cells after multifraction and single-dose radiation treatment". Oncology Reports 31.5 (2014): 2147-2156.
Chicago
Leung, C., Chen, T., Li, S., Ho, M., Hu, L., Liu, W., Wu, T. T., Hsu, P., Chang, H., Tsai, K."MicroRNA expression profiles in human breast cancer cells after multifraction and single-dose radiation treatment". Oncology Reports 31, no. 5 (2014): 2147-2156. https://doi.org/10.3892/or.2014.3089
Copy and paste a formatted citation
x
Spandidos Publications style
Leung C, Chen T, Li S, Ho M, Hu L, Liu WS, Wu TT, Hsu P, Chang H, Tsai K, Tsai K, et al: MicroRNA expression profiles in human breast cancer cells after multifraction and single-dose radiation treatment. Oncol Rep 31: 2147-2156, 2014.
APA
Leung, C., Chen, T., Li, S., Ho, M., Hu, L., Liu, W. ... Tsai, K. (2014). MicroRNA expression profiles in human breast cancer cells after multifraction and single-dose radiation treatment. Oncology Reports, 31, 2147-2156. https://doi.org/10.3892/or.2014.3089
MLA
Leung, C., Chen, T., Li, S., Ho, M., Hu, L., Liu, W., Wu, T. T., Hsu, P., Chang, H., Tsai, K."MicroRNA expression profiles in human breast cancer cells after multifraction and single-dose radiation treatment". Oncology Reports 31.5 (2014): 2147-2156.
Chicago
Leung, C., Chen, T., Li, S., Ho, M., Hu, L., Liu, W., Wu, T. T., Hsu, P., Chang, H., Tsai, K."MicroRNA expression profiles in human breast cancer cells after multifraction and single-dose radiation treatment". Oncology Reports 31, no. 5 (2014): 2147-2156. https://doi.org/10.3892/or.2014.3089
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team