Open Access

PRIMA-1MET induces apoptosis through accumulation of intracellular reactive oxygen species irrespective of p53 status and chemo-sensitivity in epithelial ovarian cancer cells

  • Authors:
    • Nobuhisa Yoshikawa
    • Hiroaki Kajiyama
    • Kae Nakamura
    • Fumi Utsumi
    • Kaoru Niimi
    • Hiroko Mitsui
    • Ryuichiro Sekiya
    • Shiro Suzuki
    • Kiyosumi Shibata
    • David Callen
    • Fumitaka Kikkawa
  • View Affiliations

  • Published online on: March 3, 2016     https://doi.org/10.3892/or.2016.4653
  • Pages: 2543-2552
  • Copyright: © Yoshikawa et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

There is an intensive need for the development of novel drugs for the treatment of epithelial ovarian cancer (EOC), the most lethal gynecologic malignancy due to the high recurrence rate. TP53 mutation is a common event in EOC, particularly in high-grade serous ovarian cancer, where it occurs in more than 90% of cases. Recently, PRIMA-1 and PRIMA‑1MET (p53 reactivation and induction of massive apoptosis and its methylated form) were shown to have an antitumor effect on several types of cancer. Despite that PRIMA-1MET is the first compound evaluated in clinical trials, the antitumor effects of PRIMA-1MET on EOC remain unclear. In this study, we investigated the therapeutic potential of PRIMA-1MET for the treatment of EOC cells. PRIMA-1MET treatment of EOC cell lines (n=13) resulted in rapid apoptosis at various concentrations (24 h IC50 2.6-20.1 µM). The apoptotic response was independent of the p53 status and chemo-sensitivity. PRIMA‑1MET treatment increased intracellular reactive oxygen species (ROS), and PRIMA-1MET-induced apoptosis was rescued by an ROS scavenger. Furthermore, RNA expression analysis revealed that the mechanism of action of PRIMA‑1MET may be due to inhibition of antioxidant enzymes, such as Prx3 and GPx-1. In conclusion, our results suggest that PRIMA-1MET represents a novel therapeutic strategy for the treatment of ovarian cancer irrespective of p53 status and chemo-sensitivity.

Introduction

Each year, more than 100,000 women die of ovarian cancer worldwide (1). Epithelial ovarian cancer (EOC) accounts for the majority of all ovarian malignancies and is one of the most lethal among gynecologic malignancies among women. In many cases, the diagnosis is delayed due to its asymptomatic nature, and, as a consequence, approximately two-thirds of patients with EOC have already developed peritoneal carcinomatosis (2,3). The prognosis of EOC patients is closely related to the stage at diagnosis (4,5).

Most ovarian cancer patients are managed with surgical resection, followed by systemic chemotherapies. Despite recent advances in therapeutic agents, such as platinum-taxane combination chemotherapy, the 5-year survival rate is still less than 40% (6). EOC shows an unfavorable oncologic outcome, based on its asymptomatic features at an earlier clinical stage, and numerous intraperitoneal and/or distant metastases. Despite the relatively high susceptibility of EOC to paclitaxel plus platinum compounds, which are first-line chemotherapeutic agents against EOC, the intrinsic or acquired resistance of tumor cells to these chemotherapies makes the treatment of EOC difficult. In order to overcome chemo-resistance, various additional molecular-targeting therapies combined with conventional anti-neoplastic agents have been developed. High-grade serous ovarian cancer (HGSOC), which is observed much more frequently at an advanced stage, comprises approximately 60% of all histological subtypes of EOC. Recent studies have revealed that most cases of HGSOC carry TP53 mutations, in contrast to other types of EOC, which have a much lower incidence of TP53 mutations (79). A recent study using high-throughput sequencing technology revealed that TP53 mutations occurred in 96% of 316 HGSOC samples (10). This suggests that somatic mutation of TP53 is a nearly universal event in HGSOC.

TP53 is located on chromosome 17p and encodes the p53 protein. Wild-type p53 functions predominately as a transcriptional factor, with a potent tumor-suppressive function via its multiple activities, including induction of cell cycle arrest, apoptosis, differentiation and senescence (11). Recent studies have shown that missense TP53 mutations not only eliminate their own tumor-suppressive function, but also gain oncogenic properties that promote tumor growth, termed gain-of-function (GOF) (12-14). Furthermore, TP53 mutations may be associated with poor prognosis and malignant phenotypes in several types of cancers, including EOC (1519). Considering the universality of the TP53 mutation in EOC, several novel drugs restoring the p53 pathway have been widely investigated to be utilized in cancer therapy.

PRIMA-1 (p53 reactivation and induction of massive apoptosis) and its methylated form PRIMA-1MET are small molecules that can convert mutant p53 to an active conformation, which restores wild-type functions of p53 in several types of cancers, such as breast, neck and thyroid cancer and melanoma (2023). PRIMA-1MET is one of the most promising drugs for clinical use to restore wild-type functions to mutant p53 (24). Although PRIMA-1MET is the first compound of such drugs evaluated in clinical trials, the antitumor effects of PRIMA-1MET on EOC remain unclear.

In our present study, we investigated whether PRIMA-1MET induces growth suppression and apoptosis in EOC cells. Using EOC cells with either wild-type or mutant p53, and with either chemo-sensitivity or chemo-resistance, we demonstrated that PRIMA-1MET was able to effectively induce cell death. Therefore, PRIMA-1MET can be a promising therapeutic strategy to induce cytotoxic effects and reactivate the p53 pathway in EOC, particularly in HGSOC.

Materials and methods

Cell culture

Human EOC lines, A2780, OVCAR-3, ES-2, SKOV-3, CaOV-3, TOV21G and OV-90, were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). NOS2 and NOS3 cell lines derived from serous EOC were previously established in our institute (25). The NOS2CR and NOS2TR cells with chronic resistance to cisplatin and paclitaxel were previously established from the parental NOS2 cells in our institute (26). Furthermore, we recently established another two chronic cisplatin/paclitaxel-resistant cell lines from the parental NOS3 cells: NOS3CR (cisplatin) and NOS3TR (paclitaxel). All EOC cell lines were maintained at 37°C with 5% CO2 in RPMI-1640 medium (Sigma) supplemented with 10% fetal bovine serum (FBS), streptomycin (100 µg/ml), and penicillin (100 U/ml). PRIMA-1MET was purchased from Santa Cruz Biotechnology, Inc. PRIMA-1MET was diluted in dimethyl sulfoxide (DMSO) to create a 50-mmol/l stock solution and stored at −20°C. Antibodies to p53 (610184) were purchased from BD Pharmingen. Antibodies to cleaved-PARP, PARP and β-actin were purchased from Cell Signaling Technology.

Direct sequencing of TP53 mutations

Genomic DNA was extracted from the NOS2 and NOS3 cells using the Genomic DNA purification kit (Promega, Madison, WI, USA). The exons and flanking introns of TP53 were amplified by polymerase chain reaction (PCR). The primers used are shown in Table I. The resulting PCR products were sequenced and the mutation status was confirmed.

Table I

The specific primers used for direct sequencing of the TP53 gene.

Table I

The specific primers used for direct sequencing of the TP53 gene.

PrimerSequenceLength (bp)
p53
 Exon 2–4F: GTGTCTCATGCTGGATCCCCACT23
R: GGATACGGCCAGGCATTGAAGT22
 Exon 5–6F: TGCAGGAGGTGCTTACGCATGT22
R: CCTTAACCCCTCCTCCCAGAGAC23
 Exon 7–9F: ACAGGTCTCCCCAAGGCGCACT22
R: TTGAGGCATCACTGCCCCCTGAT23
 Exon 10F: GTCAGCTGTATAGGTACTTGAAGTGCAG28
R: GCTCTGGGCTGGGAGTTGCG20
 Exon 11F: CCTTAGGCCCTTCAAAGCATTGGTCA26
R: GTGCTTCTGACGCACACCTATTGCAAG27

[i] F, forward; R, reverse.

RNA extraction

RNA extraction from the cells was undertaken using the Qiagen RNeasy Mini kit according to the manufacturer's protocols. The cells were lysed in 250 µl of buffer RLT and filtered through the filtration spin column. The samples were applied to the RNeasy Mini spin column. Total RNA bound to the membrane and contaminants were removed by washing consecutively with buffers RW1 and RPE. RNA was eluted in RNase-free water. Extracted RNA was immediately stored at −80°C. The RNA concentration was determined with the NanoDrop 1000 spectrophotometer.

Reverse transcription

To obtain complementary DNA (cDNA), 1 µg of RNA and 0.2 µg of random primers (Promega) were used. After incubation at 72°C for 4 min, the mixture of RNA and random primers were placed on ice for 4 min. M-MLV RT 1X reaction buffer, M-MLV Reverse Transcriptase RNase Minus, and 10 mM dNTP (Promega) were added to the mixture and then incubated at 42°C for 90 min, followed by 70°C for 15 min. cDNA was stored at −20°C.

Quantitative real-time PCR (qRT-PCR)

Quantitative RT-PCR (qRT-PCR) was performed on the Takara PCR thermal cycler using the SYBR Green detection system (Takara, Tokyo, Japan). Cycling conditions consisted of a 3-min hot start at 95°C, followed by 40 cycles of denaturation at 95°C for 10 sec, annealing at 58–60°C for 10 sec, extension at 72°C for 10 sec, and then a final inactivation at 95°C for 10 sec. Dissociation curve analyses were carried out at the end of the cycling to confirm that one specific product was measured in each reaction. Relative quantification was performed using the ΔΔCT method (27). Expression normalization was conducted by the expression of GAPDH, a housekeeping gene shown to have stable expression in cancer cell lines (28). The specific primers for each gene are shown in Table II. All experiments were performed in triplicate.

Table II

The specific primers used for quantitative real-time RT-PCR.

Table II

The specific primers used for quantitative real-time RT-PCR.

PrimerSequenceLength (bp)
PRX3F: GACGCTCAAATGCTTGATGA20
R: GATTTCCCGAGACTACGGTG20
GPX1F: AAGAGCATGAAGTTGGGCTC20
R: CAACCAGTTTGGGCATCAG19
GAPDHF: TTGGTATCGTGGAAGGACTCA22
R: TGTCATCATATTTGGCAGGTT21

[i] F, forward; R, reverse.

Protein extraction and western blot analysis

Cultured ovarian cancer cells were washed with PBS and lysed in RIPA buffer (Millipore). The cells were scrapped into lysis buffer, centrifuged at 12,000 × g at 4°C for 15 min, and then diluted in 2X sample buffer [125 mM Tris-HCl (pH 6.8), 4% SDS, 10% glycerol, 0.01% bromophenol blue, and 10% 2-mercaptoethanol]. Equal amounts of protein (10 µg) were mixed with the 2X sample buffer and were boiled at 95°C for 5 min. The samples were loaded and separated by 7.5–15% SDS-polyacrylamide gel electrophoresis (PAGE) with running buffer. The separated proteins were transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 1% skim milk, incubated with each primary antibody overnight at 4°C, washed with TBS-T buffer (10 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.05% Tween-20) and incubated with the secondary antibodies. The proteins were visualized using enhanced chemiluminescence (GE Healthcare Bio-Sciences, Uppsala, Sweden).

Cell viability assay

The effect of PRIMA-1MET on the viability of human EOC cells was evaluated with the CellTiter-Glo Luminescent Cell Viability Assay (Promega), which quantifies living cells by ATP signal intensity. The luminescent signal was determined with a luminometer. Cells were seeded in triplicate in 96-well plates at a density of 2,000 cells/well. After a 24-h culture, the cells were treated with various concentrations of PRIMA-1MET, and then incubated for 24–72 h. Control cells were treated with the same concentration of DMSO as that of the PRIMA-1MET-treated cells.

Detection of apoptosis by staining with Annexin V-FITC and propidium iodide

Cells (2×105) were cultured in 6-well plates for 24 h before treatment with DMSO (control) or an appropriate concentration of PRIMA-1MET for 24 h. The cells were trypsinized, washed once with PBS, and then stained with Annexin V-FITC and propidium iodide (PI) to determine the early/late apoptotic cell population (MBL, Japan).

Results

Protein expression of p53 and the TP53 status in EOC cells

Firstly, we evaluated the levels of p53 protein expression in the EOC cells by western immunoblot analysis. The mutation status of TP53 in the EOC cells was acquired from previous studies. The mutation status of TP53 of NOS2 and NOS3 cells was evaluated by direct sequencing. The TP53 status of EOC cells is shown in Table III. The protein expression of p53 is shown in Fig. 1. EOC cells with wild-type p53, A2780 and NOS2, displayed a basal expression of p53 to some extent. On the contrary, we could not detect the protein expression of p53 in the EOC cells with mutant p53, except for the ES-2 cells. This result demonstrates that EOC cells bearing mutant p53 do not always express a higher level of p53 than those bearing wild-type p53.

Table III

TP53 status of the EOC cell lines.

Table III

TP53 status of the EOC cell lines.

Cancer cell linesp53 status
ES-2S241F
OV-90S215R
OVCAR-3R248Q
TOV21GWild-type
A2780Wild-type
CaOV-3Q136Term
SKOV-3Null
NOS2Wild-type
NOS3L257P
The effect of PRIMA-1MET on cell death and apoptotic morphological changes in EOC cells

To assess the effect of PRIMA-1MET on EOC cells, the anti-proliferative effects of various concentrations of PRIMA-1MET (approximately 0–100 µM) were determined in a total of 9 EOC cell lines: TOV21G, A2780, ES-2, OV-90, OVCAR-3, CaOV-3, SKOV-3, NOS2 and NOS3. Fig. 2a shows the cell viability of wild-type p53 cell lines (TOV21G, A2780, and NOS2) and mutant p53 cell lines (ES-2, OV-90, OVCAR-3, CaOV-3, NOS3 and SKOV-3) treated with PRIMA-1MET for 48 h. PRIMA-1MET reduced cell viability after 48 h in all EOC cell lines in a dose-dependent manner. The IC50 values of PRIMA-1MET ranged from 2.6 to 20.1 µM, which were independent of the mutation status of TP53 (Fig. 2b). Furthermore, PRIMA-1MET treatment induced a morphological change which was consistent with the apoptotic change within 6–24 h (Fig. 2c). We next investigated whether PRIMA-1MET had sufficient effects on cisplatin- and paclitaxel-resistant cell lines, which were previously developed from the parental NOS2 and NOS3 cells (NOS2CR, NOS2TR, NOS3CR, and NO3TR). Dose-responsive cell viability assays with PRIMA-1MET were performed to evaluate the sensitivities of the chemo-resistant cells. As shown in Fig. 2d, PRIMA-1MET displayed anti-proliferative effects on both the parental and chemo-resistant cells. The IC50 values of the NOS2, NOS2CR, and NOS2TR cells were 6.5, 7.4, and 8.8 µM, respectively. The IC50 value of the NOS3CR cells was slightly higher than the values of the NOS3 and NOS3TR cells (not significant). PRIMA-1MET had sufficient growth-suppressing activity regardless of the mutation status of the TP53 and the chemo-sensitivity in the EOC cells.

PRIMA-1MET induces apoptosis in a dose-dependent manner in the EOC cells

We next performed an Annexin V-FITC/PI staining assay to investigate whether PRIMA-1MET actually induced apoptosis in the EOC cells. Treatment with PRIMA-1MET for 16 h against EOC cells, TOV21G and A2780, increased the fraction of early and late apoptotic cells (Fig. 3a). In the TOV21G cells, the fractions of early and late apoptotic cells were significantly increased from 1.1 and 4.3% following control vehicle treatment to 3.3 and 54.5% following 20 µM of PRIMA-1MET treatment, respectively (Fig. 3b). In the A2780 cells, the proportion of late apoptotic cells was significantly elevated from 5.3% following control vehicle treatment to 17.6% following 20 µM treatment (Fig. 3b). To determine whether PRIMA-1MET also induced apoptosis in chemo-resistant EOC cells, we evaluated cell apoptosis in another manner using fluorescence microscopy. The cells after a 24-h treatment with PRIMA-1MET were fixed with 4% paraformaldehyde, stained with Hoechst 33342, and then we identified apoptosis with fluorescence microscopy. The cells which had fragmented or condensed nuclei were defined as undergoing apoptosis and counted manually with fluorescence microscopy (29). The representative images of condensed nuclei are shown in Fig. 3c. PRIMA-1MET treatment significantly increased the fractions of apoptotic cells with fragmented or condensed nuclei in both parental cells and their chemo-resistant cells in a dose-dependent manner (Fig. 3d). These results indicate that PRIMA-1MET induces apoptotic cell death in both chemo-sensitive and chemo-resistant EOC cells.

PRIMA-1MET activates PARP cleavage

In order to confirm whether PRIMA-1MET-induced cell death is apoptotic, we evaluated the apoptosis-related protein levels after treatment with PRIMA-1MET in EOC cells by western blot analysis. Immunoblot analysis elucidated that PRIMA-1MET induced dose-dependent PARP cleavage in the NOS2 and NOS3 cells and in their chemo-resistant cells (Fig. 4). This result showed that PRIMA-1MET induces apoptosis in EOC cells through PARP cleavage.

PRIMA-1MET increases intracellular ROS in EOC cells

As it was reported that PRIMA-1MET induces intracellular ROS accumulation, we investigated intracellular ROS accumulation using 5–6-chloromethyl-2′7′-dichlorodihydroflorescein diacetate, acetyl ester (CM-H2DCFDA; Molecular Probes Invitrogen, Carlsbad, CA, USA) (20,30). PRIMA-1MET treatment for 24 h promoted intracellular ROS accumulation in the NOS2 and NOS3 cells, and their chemo-resistant cells (Fig. 5a). To quantify the proportion of fluorescence-positive cells in the TOV21G cells after a 24-h treatment with PRIMA-1MET, fluorescence activated cell sorting (FACS) was performed. The proportion of fluorescence-positive cells was increased in the cells treated with PRIMA-1MET in a dose-dependent manner, and the increase was significant (Fig. 5b and c). These results demonstrate that PRIMA-1MET promotes intracellular ROS accumulation in EOC cells.

ROS scavenger rescues apoptosis induced by PRIMA-1MET

To determine whether intracellular ROS accumulation by treatment with PRIMA-1MET induces apoptosis, we used a ROS scavenger N-acetyl cysteine (NAC). The compound NAC was added to cultured cells with 20 µM PRIMA-1MET medium at a final concentration of 10 mM. Sixteen hours after co-treatment with PRIMA-1MET and NAC, apoptotic cells were assessed by Annexin V-FITC and PI staining. The addition of NAC inhibited apoptosis and the growth-suppressing effect induced by PRIMA-1MET treatment (Fig. 6a and b). Furthermore, to examine the effect of PRIMA-1MET on the expression of antioxidant enzymes including Prx3 and GPx-1, which scavenge intracellular ROS to sustain homeostasis, we treated TOV21G and A2780 cells with PRIMA-1MET for 20 h and, thereafter, evaluated the mRNA levels of antioxidant enzymes by real-time RT-PCR. The mRNA levels of Prx3 and GPx-1 were significantly decreased after 20 h of treatment with PRIMA-1MET in a dose-dependent manner (Fig. 6c). Our results suggest that the antitumor effects of PRIMA-1MET may be mediated by intracellular ROS accumulation, and that the intracellular ROS accumulation and the cytotoxic effect induced by PRIMA-1MET may be due to downregulation of Prx3 and GPx-1.

Discussion

Most EOC patients experience recurrent disease, despite a high rate of complete clinical remission. Although recurrent EOC patients frequently receive chemotherapy, they are basically incurable due to the acquisition of chemo-resistance. Resistance to cytotoxic agents is a major obstacle to complete cure, and a number of attempts to overcome chemo-resistance have been made in EOC (31,32). While much effort has been made to restore chemo-sensitivity to resistant cells, no promising molecules have been identified. Thus, there is a need to develop novel therapeutics for EOC. Despite the fact that PRIMA-1MET has been confirmed to exhibit tumor-suppressing effects on various types of cancer cells, there have been few reports on the effect of PRIMA-1MET on chemo-resistant cells in EOC (3335). In our present study, we attempted to verify whether PRIMA-1MET has antitumor effects on EOC cells.

PRIMA-1MET is a prodrug converted to MQ with potential to bind to cysteine residues and change the conformation of the core domain of mutant p53 (30). PRIMA-1/PRIMA-1MET has been reported to synergize with cytotoxic agents to induce apoptotic cell death (33,36,37). Recently, Mohell et al reported that combined treatment with APR-246 and platinum or other drugs could give rise to an improved strategy for recurrent high-grade serous ovarian cancer (37). In this study, chemo-resistant cells incubated with PRIMA-1MET exhibited apoptosis, which was characterized by morphological features, such as chromosomal DNA condensation and fragmentation. Furthermore, the effect of PRIMA-1MET on cell viability of chemo-resistant cells was similar to that of the parental cells with either wild-type p53 (NOS2) or mutant p53 (NOS3). These findings suggest that PRIMA-1MET may have the possibility to be used for patients with chemo-resistant EOC bearing not only mutant p53 but also wild-type p53.

EOC cells easily spread to the peritoneal cavity and form disseminated metastases with a large amount of ascites. During this metastatic process, tumors may gradually acquire stem-like properties and become chemo-resistant. To our knowledge, there has been no report examining the efficacy of PRIMA-1MET in cancer stem cells (or cancer stem-like cells). On the other hand, a recent study suggested the possibility that PRIMA-1MET may overcome the chemo-resistance of EOC cells (37). Indeed, PRIMA-1MET may be able to target cancer stem cells with chemo-resistant properties although additional studies are warranted.

In the present study, we investigated the efficacy of PRIMA-1MET in the growth suppression and apoptosis induction in ovarian cancer cell lines (n=9) in vitro. We demonstrated that PRIMA-1MET suppressed cell viability and induced massive apoptosis, regardless of the TP53 mutational status. Furthermore, ovarian cancer cell lines carrying wild-type p53 were slightly more sensitive than those carrying mutant p53 (not significant). To date, previous reports have shown that PRIMA-1/PRIMA-1MET were more effective on pancreatic and small cell lung cancer cells expressing mutant p53 than on those expressing wild-type p53 or null (38,39). Interestingly, despite the fact that there is evidence that PRIMA-1MET restores the wild-type p53 function to mutant p53, several recent studies have shown that PRIMA-1MET displayed cytotoxic effects on Ewing sarcoma cells, acute myeloid leukemia cells, and human myeloma cells irrespective of the TP53 mutational status (4042). This controversy is because PRIMA-1MET not only restores wild-type p53 function to mutant p53, but also induces apoptosis in a p53-independent manner through intracellular ROS accumulation and endoplasmic reticulum (ER) stress (40,41). Indeed, in this study, we demonstrated that incubation with PRIMA-1MET resulted in an antitumor effect with intracellular ROS accumulation in ovarian cancer cells, and co-treatment with PRIMA-1MET and an ROS scavenger, NAC, blocked the cytotoxic effects, suggesting that the effects of PRIMA-1MET are due to an intracellular ROS increase in EOC cells. Our results were partly consistent with previous reports, and support the antitumor effects of PRIMA-1MET being universal irrespective of the TP53 mutational status in EOC cells. Unknown diverse mechanisms of PRIMA-1MET may provide a convincing strategy for overcoming chemo-resistance in not only EOC but also other cancers.

ROS can generate oxidative stress in cells inducing DNA damage, protein degradation, peroxidation of lipids, and finally cell death at a high concentration. It is well known that cancer cells are normally more tolerant to high levels of oxidative stress than normal cells (43). One of the underlying mechanisms of cancer cells to survive under high oxidative condition is overexpression of antioxidant enzymes to scavenge ROS (44). An inhibitor of glutathione synthesis, buthionine sulfoximine (BSO) was used in a clinical situation (45). In the present study, we demonstrated that PRIMA-1MET induced intracellular accumulation and suppressed the expression of antioxidant enzymes, Prx3 and GPx-1, in EOC cells. Prx3 is one of the 2-Cys peroxiredoxin family (PRX 1–4), and operates as a reductase to metabolize ROS (46). Cunniff et al reported that knockdown of Prx3 increased oxidative stress and mitochondrial dysfunction in malignant mesothelioma cells, suggesting that Prx3 plays a critical role in cell cycle progression and sustaining the mitochondrial structure (47). Furthermore, a recent report by Song et al showed that Prx3 was highly upregulated in colon cancer stem cells, and that knockdown of Prx3 led to decreased cellular viability (48). In addition, several studies have already shown that GPx-1 protects cancer cells upon exposure to severe oxidative stress (49,50). According to our findings, PRIMA-1MET suppressed the expression of both Prx3 and GPx-1, suggesting that it may induce an intracellular ROS increase mediated by downregulation of Prx3 and GPx-1.

To our knowledge, no previous studies have confirmed intracellular ROS accumulation in benign tumor cells or normal epithelial cells. In the present study, we did not evaluate whether PRIMA-1MET induces intracellular ROS accumulation in such non-malignant or normal cells. In the living body, the majority of ROS generated by various stimulation can be degenerated by a higher antioxidant capacity derived from intrinsic ROS scavengers, resulting in weakened efficacy. We believe that the actual effects may depend on the local balance between ROS and such intrinsic scavengers. Certainly, PRIMA-1MET may induce intracellular ROS accumulation in benign or normal cells as well as tumor cells. We speculate that the carcinogenetic effect of PRIMA-1MET in such cells may be minimal. However, we cannot deny that administration of PRIMA-1MET may have some risks. Therefore, further investigation concerning the effect of PRIMA-1MET against benign or normal cells is necessary when used clinically.

In conclusion, we demonstrated that PRIMA-1MET exhibited antitumor effects on chemo-resistant cells through intracellular ROS accumulation and repressed antioxidant enzymes. To utilize PRIMA-1MET for EOC patients including chemo-resistant cases, we need to investigate further how PRIMA-1MET suppresses Prx3 and GPx-1. PRIMA-1MET is a promising compound for further development as a potential cytotoxic agent against EOC.

Acknowledgments

The authors wish to thank Dr Kathleen Pishas for the study and technical support.

References

1 

Sankaranarayanan R and Ferlay J: Worldwide burden of gynaecological cancer: The size of the problem. Best Pract Res Clin Obstet Gynaecol. 20:207–225. 2006. View Article : Google Scholar

2 

Masoumi Moghaddam S, Amini A, Morris DL and Pourgholami MH: Significance of vascular endothelial growth factor in growth and peritoneal dissemination of ovarian cancer. Cancer Metastasis Rev. 31:143–162. 2012. View Article : Google Scholar :

3 

Muñoz-Casares FC, Rufián S, Arjona-Sánchez Á, Rubio MJ, Díaz R, Casado Á, Naranjo Á, Díaz-Iglesias CJ, Ortega R, Muñoz-Villanueva MC, et al: Neoadjuvant intraperitoneal chemotherapy with paclitaxel for the radical surgical treatment of peritoneal carcinomatosis in ovarian cancer: A prospective pilot study. Cancer Chemother Pharmacol. 68:267–274. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Chan JK, Tian C, Monk BJ, Herzog T, Kapp DS, Bell J and Young RC; Gynecologic Oncology Group: Prognostic factors for high-risk early-stage epithelial ovarian cancer: A Gynecologic Oncology Group study. Cancer. 112:2202–2210. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Chan JK, Teoh D, Hu JM, Shin JY, Osann K and Kapp DS: Do clear cell ovarian carcinomas have poorer prognosis compared to other epithelial cell types? A study of 1411 clear cell ovarian cancers. Gynecol Oncol. 109:370–376. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Jemal A, Siegel R, Ward E, Hao Y, Xu J and Thun MJ: Cancer statistics, 2009. CA Cancer J Clin. 59:225–249. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Bell D, Berchuck A, Birrer M, Chien J, Cramer DW, Dao F, Dhir R, DiSaia P, Gabra H, Glenn P, et al Cancer Genome Atlas Research Network: Integrated genomic analyses of ovarian carcinoma. Nature. 474:609–615. 2011. View Article : Google Scholar

8 

Havrilesky L, Darcy M, Hamdan H, Priore RL, Leon J, Bell J and Berchuck A; Gynecologic Oncology Group Study: Prognostic significance of p53 mutation and p53 overexpression in advanced epithelial ovarian cancer: A Gynecologic Oncology Group Study. J Clin Oncol. 21:3814–3825. 2003. View Article : Google Scholar : PubMed/NCBI

9 

Risch HA, McLaughlin JR, Cole DE, Rosen B, Bradley L, Fan I, Tang J, Li S, Zhang S, Shaw PA, et al: Population BRCA1 and BRCA2 mutation frequencies and cancer penetrances: A kin-cohort study in Ontario, Canada. J Natl Cancer Inst. 98:1694–1706. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Kang HJ, Chun SM, Kim KR, Sohn I and Sung CO: Clinical relevance of gain-of-function mutations of p53 in high-grade serous ovarian carcinoma. PLoS One. 8:e726092013. View Article : Google Scholar : PubMed/NCBI

11 

Giaccia AJ and Kastan MB: The complexity of p53 modulation: Emerging patterns from divergent signals. Genes Dev. 12:2973–2983. 1998. View Article : Google Scholar : PubMed/NCBI

12 

Di Agostino S, Strano S, Emiliozzi V, Zerbini V, Mottolese M, Sacchi A, Blandino G and Piaggio G: Gain of function of mutant p53: The mutant p53/NF-Y protein complex reveals an aberrant transcriptional mechanism of cell cycle regulation. Cancer Cell. 10:191–202. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Blandino G, Levine AJ and Oren M: Mutant p53 gain of function: Differential effects of different p53 mutants on resistance of cultured cells to chemotherapy. Oncogene. 18:477–485. 1999. View Article : Google Scholar : PubMed/NCBI

14 

Dong P, Karaayvaz M, Jia N, Kaneuchi M, Hamada J, Watari H, Sudo S, Ju J and Sakuragi N: Mutant p53 gain-of-function induces epithelial-mesenchymal transition through modulation of the miR-130b-ZEB1 axis. Oncogene. 32:3286–3295. 2013. View Article : Google Scholar :

15 

Høgdall EV, Kjaer SK, Blaakaer J, Christensen L, Glud E, Vuust J and Høgdall CK: P53 mutations in tissue from Danish ovarian cancer patients: From the Danish 'MALOVA' ovarian cancer study. Gynecol Oncol. 100:76–82. 2006. View Article : Google Scholar

16 

Concin N, Hofstetter G, Berger A, Gehmacher A, Reimer D, Watrowski R, Tong D, Schuster E, Hefler L, Heim K, et al: Clinical relevance of dominant-negative p73 isoforms for responsiveness to chemotherapy and survival in ovarian cancer: Evidence for a crucial p53-p73 cross-talk in vivo. Clin Cancer Res. 11:8372–8383. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Wang Y, Helland A, Holm R, Skomedal H, Abeler VM, Danielsen HE, Tropé CG, Børresen-Dale AL and Kristensen GB: TP53 mutations in early-stage ovarian carcinoma, relation to long-term survival. Br J Cancer. 90:678–685. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Ueno Y, Enomoto T, Otsuki Y, Sugita N, Nakashima R, Yoshino K, Kuragaki C, Ueda Y, Aki T, Ikegami H, et al: Prognostic significance of p53 mutation in suboptimally resected advanced ovarian carcinoma treated with the combination chemotherapy of paclitaxel and carboplatin. Cancer Lett. 241:289–300. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Bartel F, Jung J, Böhnke A, Gradhand E, Zeng K, Thomssen C and Hauptmann S: Both germ line and somatic genetics of the p53 pathway affect ovarian cancer incidence and survival. Clin Cancer Res. 14:89–96. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Peng X, Zhang MQ, Conserva F, Hosny G, Selivanova G, Bykov VJ, Arnér ES and Wiman KG: APR-246/PRIMA-1MET inhibits thioredoxin reductase 1 and converts the enzyme to a dedicated NADPH oxidase. Cell Death Dis. 4:e8812013. View Article : Google Scholar

21 

Issaeva N, Bozko P, Enge M, Protopopova M, Verhoef LG, Masucci M, Pramanik A and Selivanova G: Small molecule RITA binds to p53, blocks p53-HDM-2 interaction and activates p53 function in tumors. Nat Med. 10:1321–1328. 2004. View Article : Google Scholar : PubMed/NCBI

22 

Russo D, Ottaggio L, Penna I, Foggetti G, Fronza G, Inga A and Menichini P: PRIMA-1 cytotoxicity correlates with nucleolar localization and degradation of mutant p53 in breast cancer cells. Biochem Biophys Res Commun. 402:345–350. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Roh JL, Kang SK, Minn I, Califano JA, Sidransky D and Koch WM: p53-Reactivating small molecules induce apoptosis and enhance chemotherapeutic cytotoxicity in head and neck squamous cell carcinoma. Oral Oncol. 47:8–15. 2011. View Article : Google Scholar :

24 

Lehmann S, Bykov VJ, Ali D, Andrén O, Cherif H, Tidefelt U, Uggla B, Yachnin J, Juliusson G, Moshfegh A, et al: Targeting p53 in vivo: A first-in-human study with p53-targeting compound APR-246 in refractory hematologic malignancies and prostate cancer. J Clin Oncol. 30:3633–3639. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Misawa T, Kikkawa F, Maeda O, Obata NH, Higashide K, Suganuma N and Tomoda Y: Establishment and characterization of acquired resistance to platinum anticancer drugs in human ovarian carcinoma cells. Jpn J Cancer Res. 86:88–94. 1995. View Article : Google Scholar : PubMed/NCBI

26 

Kajiyama H, Shibata K, Terauchi M, Yamashita M, Ino K, Nawa A and Kikkawa F: Chemoresistance to paclitaxel induces epithelial-mesenchymal transition and enhances metastatic potential for epithelial ovarian carcinoma cells. Int J Oncol. 31:277–283. 2007.PubMed/NCBI

27 

Kapitanović S, Cacev T, Antica M, Kralj M, Cavrić G, Pavelić K and Spaventi R: Effect of indomethacin on E-cadherin and beta-catenin expression in HT-29 colon cancer cells. Exp Mol Pathol. 80:91–96. 2006. View Article : Google Scholar

28 

Sugiyama K, Kajiyama H, Shibata K, Yuan H, Kikkawa F and Senga T: Expression of the miR200 family of microRNAs in mesothelial cells suppresses the dissemination of ovarian cancer cells. Mol Cancer Ther. 13:2081–2091. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Nakahara T, Iwase A, Nakamura T, Kondo M, Bayasula, Kobayashi H, Takikawa S, Manabe S, Goto M, Kotani T, et al: Sphingosine-1-phosphate inhibits H2O2-induced granulosa cell apoptosis via the PI3K/Akt signaling pathway. Fertil Steril. 98:1001.e1–1008.e1. 2012.

30 

Lambert JM, Gorzov P, Veprintsev DB, Söderqvist M, Segerbäck D, Bergman J, Fersht AR, Hainaut P, Wiman KG and Bykov VJ: PRIMA-1 reactivates mutant p53 by covalent binding to the core domain. Cancer Cell. 15:376–388. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Utsumi F, Kajiyama H, Nakamura K, Tanaka H, Mizuno M, Ishikawa K, Kondo H, Kano H, Hori M and Kikkawa F: Effect of indirect nonequilibrium atmospheric pressure plasma on anti-proliferative activity against chronic chemo-resistant ovarian cancer cells in vitro and in vivo. PLoS One. 8:e815762013. View Article : Google Scholar : PubMed/NCBI

32 

Duan Z, Choy E and Hornicek FJ: NSC23925, identified in a high-throughput cell-based screen, reverses multidrug resistance. PLoS One. 4:e74152009. View Article : Google Scholar : PubMed/NCBI

33 

Bykov VJ, Zache N, Stridh H, Westman J, Bergman J, Selivanova G and Wiman KG: PRIMA-1(MET) synergizes with cisplatin to induce tumor cell apoptosis. Oncogene. 24:3484–3491. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Supiot S, Zhao H, Wiman K, Hill RP and Bristow RG: PRIMA-1(met) radiosensitizes prostate cancer cells independent of their MTp53-status. Radiother Oncol. 86:407–411. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Ali D, Jönsson-Videsäter K, Deneberg S, Bengtzén S, Nahi H, Paul C and Lehmann S: APR-246 exhibits anti-leukemic activity and synergism with conventional chemotherapeutic drugs in acute myeloid leukemia cells. Eur J Haematol. 86:206–215. 2011. View Article : Google Scholar

36 

Nahi H, Lehmann S, Mollgard L, Bengtzen S, Selivanova G, Wiman KG, Paul C and Merup M: Effects of PRIMA-1 on chronic lymphocytic leukaemia cells with and without hemizygous p53 deletion. Br J Haematol. 127:285–291. 2004. View Article : Google Scholar : PubMed/NCBI

37 

Mohell N, Alfredsson J, Fransson Å, Uustalu M, Byström S, Gullbo J, Hallberg A, Bykov VJ, Björklund U and Wiman KG: APR-246 overcomes resistance to cisplatin and doxorubicin in ovarian cancer cells. Cell Death Dis. 6:e17942015. View Article : Google Scholar : PubMed/NCBI

38 

Zandi R, Selivanova G, Christensen CL, Gerds TA, Willumsen BM and Poulsen HS: PRIMA-1Met/APR-246 induces apoptosis and tumor growth delay in small cell lung cancer expressing mutant p53. Clin Cancer Res. 17:2830–2841. 2011. View Article : Google Scholar : PubMed/NCBI

39 

Izetti P, Hautefeuille A, Abujamra AL, de Farias CB, Giacomazzi J, Alemar B, Lenz G, Roesler R, Schwartsmann G, Osvaldt AB, et al: PRIMA-1, a mutant p53 reactivator, induces apoptosis and enhances chemotherapeutic cytotoxicity in pancreatic cancer cell lines. Invest New Drugs. 32:783–794. 2014. View Article : Google Scholar : PubMed/NCBI

40 

Tessoulin B, Descamps G, Moreau P, Maïga S, Lodé L, Godon C, Marionneau-Lambot S, Oullier T, Le Gouill S, Amiot M, et al: PRIMA-1Met induces myeloma cell death independent of p53 by impairing the GSH/ROS balance. Blood. 124:1626–1636. 2014. View Article : Google Scholar : PubMed/NCBI

41 

Russo D, Ottaggio L, Foggetti G, Masini M, Masiello P, Fronza G and Menichini P: PRIMA-1 induces autophagy in cancer cells carrying mutant or wild type p53. Biochim Biophys Acta. 1833:1904–1913. 2013. View Article : Google Scholar : PubMed/NCBI

42 

Aryee DN, Niedan S, Ban J, Schwentner R, Muehlbacher K, Kauer M, Kofler R and Kovar H: Variability in functional p53 reactivation by PRIMA-1(Met)/APR-246 in Ewing sarcoma. Br J Cancer. 109:2696–2704. 2013. View Article : Google Scholar : PubMed/NCBI

43 

Tong L, Chuang CC, Wu S and Zuo L: Reactive oxygen species in redox cancer therapy. Cancer Lett. 367:18–25. 2015. View Article : Google Scholar : PubMed/NCBI

44 

Landry WD and Cotter TG: ROS signalling, NADPH oxidases and cancer. Biochem Soc Trans. 42:934–938. 2014. View Article : Google Scholar : PubMed/NCBI

45 

Bailey HH, Mulcahy RT, Tutsch KD, Arzoomanian RZ, Alberti D, Tombes MB, Wilding G, Pomplun M and Spriggs DR: Phase I clinical trial of intravenous L-buthionine sulfoximine and melphalan: An attempt at modulation of glutathione. J Clin Oncol. 12:194–205. 1994.PubMed/NCBI

46 

Cox AG, Peskin AV, Paton LN, Winterbourn CC and Hampton MB: Redox potential and peroxide reactivity of human peroxiredoxin 3. Biochemistry. 48:6495–6501. 2009. View Article : Google Scholar : PubMed/NCBI

47 

Cunniff B, Wozniak AN, Sweeney P, DeCosta K and Heintz NH: Peroxiredoxin 3 levels regulate a mitochondrial redox setpoint in malignant mesothelioma cells. Redox Biol. 3:79–87. 2014. View Article : Google Scholar : PubMed/NCBI

48 

Song IS, Jeong YJ, Jeong SH, Heo HJ, Kim HK, Bae KB, Park YH, Kim SU, Kim JM, Kim N, et al: FOXM1-induced PRX3 regulates stemness and survival of colon cancer cells via maintenance of mitochondrial function. Gastroenterology. 149:1006.e9–1016.e9. 2015. View Article : Google Scholar

49 

Huang C, Ding G, Gu C, Zhou J, Kuang M, Ji Y, He Y, Kondo T and Fan J: Decreased selenium-binding protein 1 enhances glutathione peroxidase 1 activity and downregulates HIF-1α to promote hepatocellular carcinoma invasiveness. Clin Cancer Res. 18:3042–3053. 2012. View Article : Google Scholar : PubMed/NCBI

50 

Gan X, Chen B, Shen Z, Liu Y, Li H, Xie X, Xu X, Li H, Huang Z and Chen J: High GPX1 expression promotes esophageal squamous cell carcinoma invasion, migration, proliferation and cisplatin-resistance but can be reduced by vitamin D. Int J Clin Exp Med. 7:2530–2540. 2014.PubMed/NCBI

Related Articles

Journal Cover

May 2016
Volume 35 Issue 5

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Yoshikawa, N., Kajiyama, H., Nakamura, K., Utsumi, F., Niimi, K., Mitsui, H. ... Kikkawa, F. (2016). PRIMA-1MET induces apoptosis through accumulation of intracellular reactive oxygen species irrespective of p53 status and chemo-sensitivity in epithelial ovarian cancer cells. Oncology Reports, 35, 2543-2552. https://doi.org/10.3892/or.2016.4653
MLA
Yoshikawa, N., Kajiyama, H., Nakamura, K., Utsumi, F., Niimi, K., Mitsui, H., Sekiya, R., Suzuki, S., Shibata, K., Callen, D., Kikkawa, F."PRIMA-1MET induces apoptosis through accumulation of intracellular reactive oxygen species irrespective of p53 status and chemo-sensitivity in epithelial ovarian cancer cells". Oncology Reports 35.5 (2016): 2543-2552.
Chicago
Yoshikawa, N., Kajiyama, H., Nakamura, K., Utsumi, F., Niimi, K., Mitsui, H., Sekiya, R., Suzuki, S., Shibata, K., Callen, D., Kikkawa, F."PRIMA-1MET induces apoptosis through accumulation of intracellular reactive oxygen species irrespective of p53 status and chemo-sensitivity in epithelial ovarian cancer cells". Oncology Reports 35, no. 5 (2016): 2543-2552. https://doi.org/10.3892/or.2016.4653