Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
May-2016 Volume 35 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2016 Volume 35 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Selective suppression of Notch1 inhibits proliferation of renal cell carcinoma cells through JNK/p38 pathway

  • Authors:
    • Kerong Wu
    • Linkun Hu
    • Jianquan Hou
  • View Affiliations / Copyright

    Affiliations: Department of Urology, First Affiliated Hospital, Soochow University, Suzhou, Jiangsu 215000, P.R. China
  • Pages: 2795-2800
    |
    Published online on: March 17, 2016
       https://doi.org/10.3892/or.2016.4687
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The present study was performed to explore the effects of Notch1 inhibition selectively by siRNA on the proliferation and cell cycle of renal carcinoma cells. Human renal carcinoma cell lines, 786-0 and Caki-1, were treated with Si-Notch1 or negative control (NC). RT-PCR and western blotting were used to confirm the efficiency of siRNA on Notch1 expression. MTT, cell cycle analysis, colony formation as well as migration and invasion assays were performed. The expression levels of p38 and SAPK/JNK were measured by western blotting. For both cell lines, as compared with the NC group, the cell growth was markedly reduced, and colony formation was restricted in the Si-Notch1‑treated group. After incubated with Si-Notch1 or NC for 48 h, Si-Notch1-treated cells arrested the cell cycle at G1/S phase. The Si-Notch1 group also had a reduced rate of migration as well as invasion. Moreover, we observed a reduction in p-SAPK/JNK and p-p38 in Si-Notch1 transfected cells. The present study indicated that Notch signaling is important in the tumorigenesis of renal cell carcinoma. Notch1 may be a potential therapeutic regimen towards renal cell carcinoma, and JNK/p38 may serve as an important molecular mechanism for Notch1-mediated carcinogenesis.

Introduction

Renal cell carcinoma (RCC) is the most lethal urologic cancer, representing 2–3% of all cancers (1). Although surgery is considered the primary curative therapy for patients with RCC, the prognosis for patients with metastatic disease is poor, with a 5-year survival rate of <10% (2).

Clear cell renal cell carcinoma (ccRCC), which accounts for ~80% of all RCCs, is characterized by inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene (3). Drugs targeting the HIF axis (including mTOR inhibitors) have been approved for advanced RCC (4). However, the efficacy is thought to be limited, and treatment response is not long lasting; therefore, the overall survival of ccRCC remains poor (5,6). Since the pathogenesis of ccRCC is quite complicated, it is unrealistic to expect that any single mechanism will uncover the full process. Additional tumorigenic events are supposed to contribute to the genesis and development of ccRCCs (7,8).

The Notch signaling controls a variety of cellular processes (9). Notch signaling is initiated through the interactions between the plasma-embedded Notch receptors (Notch1-4) and cell surface ligands (Jagged1 and Jagged2, and δ-like 1, 2 and 4) present on adjacent cells. The intracellular domain of Notch (ICN), is cleaved from the plasma membrane and translocates into the nucleus, leading to transcription of its downstream targets such as Hes and Hey (10).

In RCC, Notch seems to play an ‛oncogenic' role; it was previously reported that the Notch signaling cascade was constitutively active in cell lines (8), and high expression of Notch was associated with increased risk of metastasis (11). Our previous study revealed the elevated level of Notch1 and Jagged1 in ccRCC tissues compared with in normal kidney tissues (12). We also reported that Jagged1 overexpression may predict poor outcome in RCC patients (13). However, how Notch plays the oncogenic function and whether Notch pathway is a target in RCC remains unclear.

Since Notch1 was detected overexpressed in ccRCC (13), in the present study, we exclusively suppressed Notch1, explored how the inhibition would influence the survival of ccRCC cells, and detected the potential mechanism. The present study provides the information on the mechanism of tumorigenesis of RCC and highlights the potential use of Notch inhibition as a novel treatment for RCC.

Materials and methods

Reagents and antibody

The antibody used against Notch1 (polyclonal rabbit anti-human Notch1; ab27526) was purchased from Abcam (Cambridge, UK). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Tissue culture media and fetal bovine serum (FBS) were purchased from Gibco (Fullerton, CA, USA). Cell cycle analysis was performed using the Coulter DNA Prep™ reagents kit (Beckman Coulter, Fullerton, CA, USA). The Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kit was purchased from Beckman Coulter. Human renal carcinoma cell lines, 786-0 and Caki-1, were obtained from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). Other materials will be introduced in the following context.

Cell culture

Human renal carcinoma cell lines, 786-0, and Caki-1, were cultured in Dulbecco's modified Eagle's medium (Invitrogen Life Technologies, Carlsbad, CA, USA) supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin and 0.1 mg/ml streptomycin in a humidified atmosphere with 5% CO2 incubator at 37°C.

Western blotting

The cells were solubilized in a lysis buffer on ice. All lysates were centrifuged at 4°C at 10,000 × g for 10 min. The protein concentration was determined using the bicinchoninic acid protein assay kit (Pierce Biotechnology, Rockford, IL, USA). An amount of 100 mg protein content was electrophoresed in 8% SDS-PAGE and blotted on a nitrocellulose membrane. The membrane was blocked with 5% bovine serum albumin in 1X Tris-buffered saline (TBS) buffer at room temperature for 2 h and incubated Notch1 (1:200) at 4°C overnight. After three washes for 15 min in TBS, the membrane was incubated with the peroxidase-conjugated mouse anti-goat IgG antibody for 2 h at room temperature. Immunoreactive proteins were visualized by an enhanced chemiluminescence system (Immobilon, Millipore, Billerica, MA, USA) and GAPDH was used as the control for protein loading.

Reverse transcriptase-polymerase chain reaction

Total RNA from the cells was isolated with RNAiso Plus (Takara, Japan). The RNA was reverse transcribed with a PrimeScript RT reagent kit (Takara). All the procedures were conducted in accordance with the manufacturer's instructions. The resulting cDNA was quantified by RT-PCR using SYBR Premix Ex Taq (Takara). GAPDH was used as a housekeeping gene. The primer sequences were: GAGGCGTGGCAGACTATGC (forward) and CTTGTACTCCGTCAGCGTGA (reverse).

RNA interference

siRNA duplexes were produced by Shanghai GenePharma Co., Inc. (Shanghai, China) against human Notch1. Scrambled control siRNA, which was used as a negative control (NC), was also designed and obtained from GenePharma Co., Inc. (Table I).

Table I

Primers used in the present study.

Table I

Primers used in the present study.

Gene namePrimer sequence
Si-Notch1 GCACGCGGAUUAAUUUGCAdTdT
UGCAAAUUAAUCCGCGUGCdTdT
Negative control UUCUCCGAACGUGUCACGUTT
ACGUGACACGUUCGGAGAATT

Growing cells were seeded at 2×105 cells/well into a 6-well tissue culture dish. The transfection was performed using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions. In the preliminary test, different concentrations of siRNA 0, 25, 50 and 100 nM were tested. We found 50 nM Si-Notch1 achieved an efficient inhibition of Notch1. When we increased the concentration of Si-Notch1, the efficacy did not improve significantly. The final concentration of siRNA added to the cells was determined to be 50 nM. The cells were cultured in the presence of transfection mixture for 24 h; the transfection mixture was replaced by fresh RPMI-1640 medium.

Cell viability assay

Cell viability assay was performed as previously described (12). Briefly, cells were seeded into 96-well plates at a density of 1.0×104 cells/well. Following overnight incubation, the cells were treated with siRNA (50 nM) or NC for 48 h. Thereafter, the medium was removed and 20 µl MTT [5 mg/ml in phosphate-buffered saline (PBS)] was added to each well. Following incubation for 4 h at 37°C, the supernatant was removed and the formazan crystals were solubilized by adding 150 µl dimethyl sulfoxide (DMSO). Viable cells were detected by measuring absorbance at 490 nm using MRX II absorbance reader (Dynex Technologies, Chantill, VA, USA).

Colony formation assay

Cells were counted and plated at 500 cells/well in a 6-well plate. After 2 weeks, the cells were washed with PBS, fixed with methanol for 15 min at room temperature, and stained with crystal violet for 30 min and after that the number of colonies was counted.

Apoptosis

Detection of apoptotic cells by flow cytometry. Cells were plated in 6-well plates (2 ml/well) at a density of 5×105 cells/ml and incubated overnight. After siRNA treatment for 48 h, the cells were collected and washed with PBS, followed by resuspension in binding buffer at a concentration of 1×106 cells/ml. A total of 100 ml (1×105 cells) of the solution was removed and mixed with Annexin V-FITC and propidium iodide (PI) according to the manufacturer's instructions. The mixed solution was incubated in the dark at room temperature for 15 min, 400 µl dilution buffer was then added to each tube and cell apoptosis analysis was performed using the FC500 flow cytometry system (Beckman Coulter) within 1 h.

Analysis of cell cycle distribution

After exposed to Si-Notch1 or NC (50 nM) for 48 h at 37°C, cells were harvested, washed with cold PBS, fixed with 70% ethanol and stored at 4°C for subsequent cell cycle analysis. For detecting DNA content, cells were incubated in the dark at room temperature with 0.5 ml RNase A for 20 min and with 1 ml PI for 20 min. The DNA content of the cells was measured using the Beckman Coulter FC500 flow cytometry system. The percentage of cells in G1, S and G2/M phases was calculated.

Cell migration and invasion assays

For the in vitro migration and invasion assays, 5×104 cells were resuspended in serum-free medium and placed in the upper Transwell chamber (8.0-µm PC; Corning Inc., Corning, NY, USA). The lower chamber contained medium with 10% FBS. After 24 h of incubation, the migrating cells in the lower chamber or invading cells on the bottom of each well were stained with 4′,6-diamidino-2-phenylindole (1 mg/ml; Beijing Solarbio Science and Technology Co., Ltd., Beijing, China) followed by fixation in methyl alcohol for 30 min. Then, the number of cells in six randomly selected microscopic fields (magnification, ×100) was counted with a BX51 fluorescence microscope (Olympus Corporation, Tokyo, Japan).

Statistical analysis

Statistical analyses were performed using a statistical software package (SPSS, version 16.0; SPSS, Inc., Chicago, IL, USA). For MTT results, cell cycle analysis, colony-formation as well as migration and invasion assays, data from three independent experiments are presented as the mean values with standard deviations. The differences were evaluated using two-tailed Student's t-tests. P<0.05 was considered to indicate a statistically significant difference and all P-values were two-sided.

Results

Notch1 expression is markedly decreased by siRNA

We used RT-PCR and western blotting to confirm the efficiency of siRNA on Notch1 expression. After transfection, expression of Notch1 in Si-Notch1 group was reduced as compared with in the NC group (Fig. 1). For PCR, we detected a 67.3 and 45.2% reduction of Notch1 in 786-0 and Caki-1 cell lines, respectively. For western blotting, the protein of Notch1 was expressed with specific bands at 80 kDa. Notch1 protein was found to be downregulated in Si-Notch1-treated cell lines compared with the NC group for both cell lines.

Figure 1

RNA interference efficiency. Suppression of Notch1 expression by siRNA. A) Cells were transfected with the NC and Si-Notch1 for 48 h, and total RNA was analyzed by RT-PCR. B) Total protein was analyzed by western blotting with specific antibody. *P<0.05, the results were statistically significant compared to the NC group. The data are from three separate experiments.

Notch1 inhibition by RNA interference inhibits growth of tumor cells

To determine whether Notch1 signaling was responsible for cell proliferation in ccRCC, we interrupted the signaling pathway by RNA interference of Notch1. An MTT assay was carried out to measure the proliferation status of the cells. As shown in Fig. 2, inhibition of cell proliferation was detected in Si-Notch1-treated cell lines. After 48 h, in NC group, percentage of cell viability was 94.4±4.1 and 91.6±3.5% in 786-0 and Caki-1 cell lines, while in Si-Notch1 group it was 70.2±2.3 and 61.6±5.1% in 786-0 and Caki-1 cell lines. Compared to the NC group, the cell growth of Si-Notch1 group was decreased by 24.0 and 32.8% after 48 h of incubation, in 786-0 and Caki-1 cells, respectively.

Figure 2

Cell proliferation and colony formation. (A) Cell proliferation assay using MTT was performed to evaluate the growth of the two cell lines. (B) Si-Notch1 transfection inhibited the colony formation detected by colony-forming assay. The number of colonies was diminished in both cell lines following Si-Notch1 treatment. (C) Colony formation rate for 786-0 and Caki-1 cell lines following Si-Notch1 or NC transfection. (D) No obvious apoptosis was detected in either cell lines using a double-staining method with Annexin V-FITC/PI. FITC, fluorescein isothiocyanate; PI, propidium iodide. *P<0.05, the results were statistically significant compared to the NC group. The data are from three separate experiments.

We subsequently confirmed the inhibitory effects of Si-Notch1 through colony formation assays. The assay further confirmed that Si-Notch1 treatment inhibited cell proliferation. After 14 days, the colony formation rates of Si-Notch1 trans-fected cells were 7.1±1.2 and 5.7±1.2%, in 786-0 and Caki-1, respectively. In comparison, the colony formation rates of NC transfected cells were 19.7±2.2 and 15.9±1.4%, respectively. The cell colony formation rate of Si-Notch1 group was clearly suppressed as compared to the NC group, in both 786-0 and Caki-1 cell lines (P=0.003 and P=0.001, respectively) (Fig. 2).

To determine whether the Notch1 inhibition would cause cell apoptosis, flow cytometry was further used to identify the cell death types. The 786-0 and Caki-1 RCC cells treated with Si-Notch1 did not show obvious apoptosis.

Notch1 inhibition by RNA interference induces G1/S phase cell cycle arrest

Based on the growth inhibitory response of siRNA treatment in cells, its effect on cell cycle distribution was next examined. Both cell types were incubated with Si-Notch1 or NC for 48 h after which cell cycle analysis was performed. Si-Notch1-treated cells arrested the cell cycle at the G1/S phase (Table II, Fig. 3), suggesting that the MTT assay indicated cell cycle arrest.

Figure 3

Cell cycle analysis. Notch1 inhibition arrested the cell cycle at the G1/S phase, analyzed by FACS.

Table II

Negative control (NC) and Si-Notch1 cells.

Table II

Negative control (NC) and Si-Notch1 cells.

Phase786-0 (%)
PhaseCaki-1 (%)
NCSi-Notch1NCSi-Notch1
G141.29±2.3153.06±2.54G161.38±3.1973.32±4.99
S43.62±1.3437.47±4.94S26.84±1.1315.76±3.12
G215.09±1.089.47±3.14G212.11±1.9310.91±2.73
Notch1 inhibition by RNA Interference inhibits cell migration and invasion

We used Transwell migration and invasion assays to compare the cell migration and invasive capacity in each group. Fig. 4 shows results for 786-0 and Caki-1 cell lines, the Si-Notch1 group had a reduced rate of migration as well as invasion. For 786-0 cell line, the migration cell count of Si-Notch1 group was 316±58, while it was 1,271±198 in NC group (P=0.009). In addition, the invasive cell count of Si-Notch1-treated cells was 223±22, compared to 1,046±180 with the NC group (P=0.015). For Caki-1 cell line, the migration cell count was 306±53 and 1,380±102 in Si-Notch1 and NC groups, respectively (P<0.001). Moreover, the invasive cell count was 427±97 and 1,229±116 in Si-Notch1 and NC group, respectively (P=0.001).

Figure 4

Cell invasion and migration. (A and B) Notch1 interference inhibited tumor migration as well as invasion to the lower chamber (magnification, ×100). (C and D) *P<0.05, the results were statistically significant compared to the NC group. The data are from three separate experiments.

MAPK pathway is regulated by Notch1 inhibition

The cell lines were treated with Si-Notch1 or NC for 48 h, respectively. In addition, the levels of p38 and JNK were measured by western blotting. As shown in Fig. 5, the levels of phospho-p38 and phospho-JNK were downregulated at 48 h in Si-Notch1 group as compared with the NC group, for both 786-0 and Caki-1 cell lines.

Figure 5

Expression of SAPK/JNK, p38 by western blotting. The levels of p38 and JNK did not show significant difference in Si-Notch1 group when compared with NC group in either cell line. While the levels of phospho-p38 and phospho-JNK were lower in Si-Notch1 groups.

Discussion

RCC is globally the 13th most common cancer (14,15). Over the past several years, targeted therapies have increasingly become available and have shown considerable promise for the treatment of RCC; however, even with such therapies life expectancy is generally only extended by less than one year (16). New therapeutic targets are needed and thus identification of such targets could lead to the design of new drugs for use in RCC patients.

The Notch pathway is critical in the determination of cell fates by regulating cell growth, differentiation and apoptosis (9). In RCC, Notch signaling cascade was active in human ccRCC cell lines independent of the VHL/HIF pathway; Notch1 and the Notch ligand Jagged1 were expressed at significantly higher levels in ccRCC tumors than in normal human renal tissue (8). The expression level of Notch was correlated with the Furman grading, TNM staging as well as prognosis in RCC cases (13). As a basis for the present study, we discovered that Notch1 was overexpressed in RCC cell lines as well as kidney cancer tissues (12,13). Thus, we took Notch1 as our target to test how the inhibition of Notch1 exclusively would influence the biological behavior of RCC cells.

In the present study, inhibition of Notch1 with siRNA led to a considerable decrease of cell proliferation and induced cell cycle arrest. Cell colony forming was also inhibited by Si-Notch1 interference. Moreover, the capacity of invasion and migration were suppressed by Si-Notch1 treatment. The results support the therapeutic effect of Si-Notch1 for ccRCC. Though apoptosis analysis did not show a positive result, we suppose the inhibitory effect was mainly achieved by cell cycle arrest. The present study implied that the receptor Notch1, at least played a significant role in Notch pathway and thus could be considered as a promising therapeutic target. In fact, Notch pathway has been taken as a treatment target in various malignancies, and the results seemed to be encouraging (17,18). Though non-selective inhibition like Notch γ-secretase inhibitor has been reported, the side-effects could be serious when it is applied in experiments in vivo (18). Considering that, a selective inhibition of Notch seemed to be more reasonable, and given the limitation of kinase inhibitors, a comprehensive evaluation of Notch inhibition would be an alternative choice for ccRCC.

The mechanism involved with the oncogenic role of Notch may be multiple (19,20). The MAPKs comprise a well-studied family of serine threonine kinases that play important regulatory roles in the cells (21). Among the MAPK signaling pathways, JNKs and p38-MAPKs were identified to be activated in response to a variety of cellular and environmental stress such as changes in osmolarity, DNA damage, heat shock, ischemia, cytokines, UV irradiation and oxidative stress (22,23).

Although JNKs are primarily attributed to proapoptotic cell death or tumor suppression in response to a variety of stress, emerging evidence suggests that JNKs, play a role in the malignant transformation of cells and in tumorigenesis (24). Research suggests that JNK signaling contributed to cancer development (25,26). The roles of p38 in invasion and metastasis have also been reported (27), and activation of p38 has been shown in various cancers to be the mechanism promoting expression of MMP-2 (28,29). In the present study, we observed a reduction in p-SAPK/JNK and p-p38 in Si-Notch1 transfected cells, suggesting that JNK/p38 may serve downstream of the Notch pathway. This result may partly illustrate why inhibition of the Notch pathway leads to considerable inhibition of cell proliferation, and clear restriction of the invasion and migration capability. We demonstrated that the oncogenic effect of Notch1 is at least partially mediated through regulation of the JNK/p38 pathway in two ccRCC cell lines.

Deficiencies remain in the present study. Firstly, though we blocked the Notch pathway with a specific receptor, we consider that knockout of Notch1 would make the results stronger. Secondly, as a conservative pathway, Notch has a comprehensive network of its targets. To detect the downstream targets of Notch pathway, more research needs to be carried out in our following study.

In conclusion, the present study indicated that Notch signaling is important in the tumorigenesis of RCC. JNK/p38 may serve as an important molecular mechanism for Notch1-mediated carcinogenesis of ccRCC. Notch1 inhibition has the potential of being a novel therapeutic regimen for RCC.

Acknowledgments

The present study was supported by a grant from the Natural Science Foundation of Ningbo, China (2011A610054), as well as the Medicine and Hygiene Program of Zhejiang Province, China (2014KYB231). We thank Dr Wang Xiao for his assistance in study design and instruction on the experiments.

References

1 

Siegel R, Ma J, Zou Z and Jemal A: Cancer statistics, 2014. CA Cancer J Clin. 64:9–29. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Schrader AJ, Varga Z, Hegele A, Pfoertner S, Olbert P and Hofmann R: Second-line strategies for metastatic renal cell carcinoma: Classics and novel approaches. J Cancer Res Clin Oncol. 132:137–149. 2006. View Article : Google Scholar

3 

Vogelzang NJ and Stadler WM: Kidney cancer. Lancet. 352:1691–1696. 1998. View Article : Google Scholar : PubMed/NCBI

4 

Motzer RJ, Hutson TE, Tomczak P, Michaelson MD, Bukowski RM, Rixe O, Oudard S, Negrier S, Szczylik C, Kim ST, et al: Sunitinib versus interferon alfa in metastatic renal-cell carcinoma. N Engl J Med. 356:115–124. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Yang L, Yu SY and Hu GY: Pituitary metastasis from a renal cell carcinoma progressed after sorafenib treatment. Chin J Cancer. 32:353–356. 2013. View Article : Google Scholar :

6 

Zhang ZL, Li YH, Xiong YH, Hou GL, Yao K, Dong P, Liu ZW, Han H, Qin ZK and Zhou FJ: Oncological outcome of surgical treatment in 336 patients with renal cell carcinoma. Chin J Cancer. 29:995–999. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Majid S, Saini S and Dahiya R: Wnt signaling pathways in urological cancers: Past decades and still growing. Mol Cancer. 11:72012. View Article : Google Scholar : PubMed/NCBI

8 

Sjölund J, Johansson M, Manna S, Norin C, Pietras A, Beckman S, Nilsson E, Ljungberg B and Axelson H: Suppression of renal cell carcinoma growth by inhibition of Notch signaling in vitro and in vivo. J Clin Invest. 118:217–228. 2008. View Article : Google Scholar

9 

Artavanis-Tsakonas S, Rand MD and Lake RJ: Notch signaling: Cell fate control and signal integration in development. Science. 284:770–776. 1999. View Article : Google Scholar : PubMed/NCBI

10 

Iso T, Kedes L and Hamamori Y: HES and HERP families: Multiple effectors of the Notch signaling pathway. J Cell Physiol. 194:237–255. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Ai Q, Ma X, Huang Q, Liu S, Shi T, Zhang C, Zhu M, Zhang Y, Wang B, Ni D, et al: High-level expression of Notch1 increased the risk of metastasis in T1 stage clear cell renal cell carcinoma. PLoS One. 7:e350222012. View Article : Google Scholar : PubMed/NCBI

12 

Wu K, Zhang L, Lin Y, Yang K and Cheng Y: Inhibition of γ-secretase induces G2/M arrest and triggers apoptosis in renal cell carcinoma. Oncol Lett. 8:55–61. 2014.PubMed/NCBI

13 

Wu K, Xu L, Zhang L, Lin Z and Hou J: High Jagged1 expression predicts poor outcome in clear cell renal cell carcinoma. Jpn J Clin Oncol. 41:411–416. 2011. View Article : Google Scholar

14 

Chow WH, Dong LM and Devesa SS: Epidemiology and risk factors for kidney cancer. Nat Rev Urol. 7:245–257. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Ljungberg B, Campbell SC, Choi HY, Jacqmin D, Lee JE, Weikert S and Kiemeney LA: The epidemiology of renal cell carcinoma. Eur Urol. 60:615–621. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Escudier B, Eisen T, Stadler WM, Szczylik C, Oudard S, Siebels M, Negrier S, Chevreau C, Solska E, Desai AA, et al TARGET Study Group: Sorafenib in advanced clear-cell renal-cell carcinoma. N Engl J Med. 356:125–134. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Rasul S, Balasubramanian R, Filipović A, Slade MJ, Yagüe E and Coombes RC: Inhibition of gamma-secretase induces G2/M arrest and triggers apoptosis in breast cancer cells. Br J Cancer. 100:1879–1888. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Wei P, Walls M, Qiu M, Ding R, Denlinger RH, Wong A, Tsaparikos K, Jani JP, Hosea N, Sands M, et al: Evaluation of selective gamma-secretase inhibitor PF-03084014 for its antitumor efficacy and gastrointestinal safety to guide optimal clinical trial design. Mol Cancer Ther. 9:1618–1628. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Hellström M, Phng LK, Hofmann JJ, Wallgard E, Coultas L, Lindblom P, Alva J, Nilsson AK, Karlsson L, Gaiano N, et al: Dll4 signalling through Notch1 regulates formation of tip cells during angiogenesis. Nature. 445:776–780. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Qi R, An H, Yu Y, Zhang M, Liu S, Xu H, Guo Z, Cheng T and Cao X: Notch1 signaling inhibits growth of human hepatocellular carcinoma through induction of cell cycle arrest and apoptosis. Cancer Res. 63:8323–8329. 2003.PubMed/NCBI

21 

Johnson GL and Lapadat R: Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science. 298:1911–1912. 2002. View Article : Google Scholar : PubMed/NCBI

22 

Chang Q, Zhang Y, Beezhold KJ, Bhatia D, Zhao H, Chen J, Castranova V, Shi X and Chen F: Sustained JNK1 activation is associated with altered histone H3 methylations in human liver cancer. J Hepatol. 50:323–333. 2009. View Article : Google Scholar

23 

Wada T and Penninger JM: Mitogen-activated protein kinases in apoptosis regulation. Oncogene. 23:2838–2849. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Liu J and Lin A: Role of JNK activation in apoptosis: A double-edged sword. Cell Res. 15:36–42. 2005. View Article : Google Scholar : PubMed/NCBI

25 

Barbarulo A, Iansante V, Chaidos A, Naresh K, Rahemtulla A, Franzoso G, Karadimitris A, Haskard DO, Papa S and Bubici C: Poly(ADP-ribose) polymerase family member 14 (PARP14) is a novel effector of the JNK2-dependent pro-survival signal in multiple myeloma. Oncogene. 32:4231–4242. 2013. View Article : Google Scholar

26 

Hui L, Zatloukal K, Scheuch H, Stepniak E and Wagner EF: Proliferation of human HCC cells and chemically induced mouse liver cancers requires JNK1-dependent p21 downregulation. J Clin Invest. 118:3943–3953. 2008. View Article : Google Scholar : PubMed/NCBI

27 

del Barco Barrantes I and Nebreda AR: Roles of p38 MAPKs in invasion and metastasis. Biochem Soc Trans. 40:79–84. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Kim ES, Kim MS and Moon A: TGF-β-induced upregulation of MMP-2 and MMP-9 depends on p38 MAPK, but not ERK signaling in MCF10A human breast epithelial cells. Int J Oncol. 25:1375–1382. 2004.PubMed/NCBI

29 

Kumar B, Koul S, Petersen J, Khandrika L, Hwa JS, Meacham RB, Wilson S and Koul HK: p38 mitogen-activated protein kinase-driven MAPKAPK2 regulates invasion of bladder cancer by modulation of MMP-2 and MMP-9 activity. Cancer Res. 70:832–841. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wu K, Hu L and Hou J: Selective suppression of Notch1 inhibits proliferation of renal cell carcinoma cells through JNK/p38 pathway. Oncol Rep 35: 2795-2800, 2016.
APA
Wu, K., Hu, L., & Hou, J. (2016). Selective suppression of Notch1 inhibits proliferation of renal cell carcinoma cells through JNK/p38 pathway. Oncology Reports, 35, 2795-2800. https://doi.org/10.3892/or.2016.4687
MLA
Wu, K., Hu, L., Hou, J."Selective suppression of Notch1 inhibits proliferation of renal cell carcinoma cells through JNK/p38 pathway". Oncology Reports 35.5 (2016): 2795-2800.
Chicago
Wu, K., Hu, L., Hou, J."Selective suppression of Notch1 inhibits proliferation of renal cell carcinoma cells through JNK/p38 pathway". Oncology Reports 35, no. 5 (2016): 2795-2800. https://doi.org/10.3892/or.2016.4687
Copy and paste a formatted citation
x
Spandidos Publications style
Wu K, Hu L and Hou J: Selective suppression of Notch1 inhibits proliferation of renal cell carcinoma cells through JNK/p38 pathway. Oncol Rep 35: 2795-2800, 2016.
APA
Wu, K., Hu, L., & Hou, J. (2016). Selective suppression of Notch1 inhibits proliferation of renal cell carcinoma cells through JNK/p38 pathway. Oncology Reports, 35, 2795-2800. https://doi.org/10.3892/or.2016.4687
MLA
Wu, K., Hu, L., Hou, J."Selective suppression of Notch1 inhibits proliferation of renal cell carcinoma cells through JNK/p38 pathway". Oncology Reports 35.5 (2016): 2795-2800.
Chicago
Wu, K., Hu, L., Hou, J."Selective suppression of Notch1 inhibits proliferation of renal cell carcinoma cells through JNK/p38 pathway". Oncology Reports 35, no. 5 (2016): 2795-2800. https://doi.org/10.3892/or.2016.4687
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team