Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
October-2017 Volume 38 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2017 Volume 38 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Pseudolaric acid B inhibits neuroglioma cell proliferation through DNA damage response

  • Authors:
    • Fengmei Song
    • Xiaoyan Yu
    • Haipeng Zhang
    • Zengyan Wang
    • Yue Wang
    • Xiangling Meng
    • Jinghua Yu
  • View Affiliations / Copyright

    Affiliations: Institute of Virology and AIDS Research, The First Hospital of Jilin University, Jilin University, Changchun, Jilin 130021, P.R. China, Department of Experimental Pharmacology and Toxicology, School of Pharmacy, Jilin University, Changchun, Jilin 130000, P.R. China, Department of Gynaecology, The First Hospital of Jilin University, Jilin University, Changchun, Jilin 130000, P.R. China, Department of Internal Medicine, The First Hospital of Jilin University, Jilin University, Changchun, Jilin 130000, P.R. China, Chemistry of Traditional Chinese Medicine, College of Pharmacy, Changchun University of Chinese Medicine, Changchun, Jilin 130000, P.R. China
  • Pages: 2211-2218
    |
    Published online on: August 1, 2017
       https://doi.org/10.3892/or.2017.5861
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Human neuroglioma is one of the most common malignant intracranial tumors in neurosurgery, and accounts for more than 50% of all brain cancer cases. Thus, a clinically effective drug with which to treat neuroglioma is urgently required. Pseudolaric acid B (PAB), a diterpene acid isolated from the root and trunk bark of Pseudolarix kaempferi Gordon (Pinaceae), was found to inhibit cell growth in a variety of cancer cell lines, but to date the effect of PAB on neuroglioma remains unclear. MTT analysis confirmed that PAB inhibited neuroglioma A172 cell growth in a time- and dose-dependent manner. In addition, PAB influenced the aggregation of tubulin in A172 cells. Meanwhile following PAB treatment, a higher percentage of cells accumulated in the G2/M phase from 12 to 48 h, while at 36 h, cell cycle slippage into the G0/G1 phase, and at 48 h, slippage into the S phase was observed using flow cytometric analysis. Corresponding protein expression was consistent with the cell cycle alteration as detected by western blotting, and it was speculated that cell cycle slippage was related to reduced effectiveness of PAB which warrants further investigation. Meanwhile PAB induced cell death by regulating p38, ERK and JNK expression and activating the DNA damage response. Therefore, PAB plays an antitumor role in A172 cells, and may be a candidate drug for neuroglioma therapy.

Introduction

Pseudolaric acid B (PAB) is a diterpene acid isolated from the root and trunk bark of Pseudolarix kaempferi Gordon (Pinaceae), known as ‘Tu-Jin-Pi’ in Chinese. PAB has been used to treat dermatological fungal infections. PAB was found to exert potent inhibitory activity on cell growth in vitro in various tumor cell lines (1–6) through cell cycle arrest, apoptosis or autophagy. However, to date the role of PAB in neuroglial cells is not clear.

Human neuroglioma is one of the most common malignant intracranial tumors in neurosurgery, and accounts for more than 50% of all brain cancer cases, and is recently diagnosed in a younger population (7,8). The pathogenesis of neuroglioma is related to multiple processes affected by dozens of regulatory factors (9); however, our knowledge concerning the underlying factors regulating neuroglioma progression remains unknow, and clinically effective drugs to treat neuroglioma are urgently required.

The DNA damage response, caused by a variety of stimuli, arrests the cell cycle to allow damage repair or direct cell apoptosis (10). Apoptosis, as one type of antitumor mechanism, has been a focus of numerous studies for antitumor drug development (11,12). In mammalian cells, the MAPK pathway is involved in cell proliferation or cell death: stress-activated protein kinase/c-Jun-N-terminal kinase (Sapk/Jnk), p38 kinase and extracellular signal-regulated kinase (Erk) (13). Generally, Erk protein promotes inflammation, apoptosis, growth, differentiation, oncogenic transformation, while Jnk and p38 are implicated in growth, differentiation and development (14,15). Cell cycle arrest is important after eukaryotic normal cell cycle progression is affected. These regulatory pathways are commonly referred to as cell cycle checkpoints (16). Cells are arrested at cell cycle checkpoints temporarily to allow for: i) cellular damage to be repaired; ii) the dissipation of an exogenous cellular stress signal; or iii) the availability of essential growth factors, hormones or nutrients.

In the present study, we showed that PAB inhibited neuroglioma cell proliferation and cell migration through influencing tubulin aggregation. Meanwhile, PAB further induced DNA damage response to induce cell cycle arrest and cell death, which may provide a strategy to increase the antitumor effect of PAB.

Materials and methods

Materials

PAB, which was purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China), was dissolved in dimethyl sulfoxide (DMSO) to make a stock solution. DMSO concentration was maintained at <0.01% in all the cell cultures, and did not exert any detectable effect on cell growth or cell death. Propidium iodode (PI), phalloidin-tetramethylrhodamine B isothiocyanate, Hoechst 33258 and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Sigma Chemical Co. (St. Louis, MO, USA). TRIzol reagent and SuperScript™ III RT-PCR kit were purchased from Invitrogen (Carlsbad, CA, USA). Power SYBR-Green PCR Master Mix was purchased from ABI (Vernon, CA, USA). Caffeine was purchased from Shanghai YuanYe Biological Technology Co., Ltd. (Shanghai, China). The following mouse or rabbit antibodies were used in the western blot analyses: anti-CDK2 (Cell Signaling Technology, Inc., Danvers, MA, USA), anti-cyclin E1, anti-cyclin A2 (both from ProteinTech Group, Chicago, IL, USA), anti-CDK6, anti-cyclin D (both from Cell Signaling Technology, Inc.), anti-CDK1 (Boster Biological Technology Co., Ltd., Wuhan, China), anti-cyclin B1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), anti-JNK1 and 2, anti-MAPK14 (p38) (both from Boster Biological Technology Co., Ltd.), anti-ERK1/2 (ProteinTech Group), anti-histone H3 (Amersham Pharmacia Biotech, Piscataway, NJ, USA), anti-γ-h2ax (Cell Signaling Technology, Inc.), anti-actin, and alkaline phosphatase labeled-secondary antibodies (both obtained from Santa Cruz Biotechnology, Inc.).

Cell culture

The human glioblastoma A172 (CRL-1620™) cell line was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA), and was cultured in Dulbeccos modified Eagles medium (DMEM) (HyClone, Logan, UT, USA) supplemented with 10% fetal calf serum (FCS), 2 mM glutamine (both from Gibco-BRL, Grand Island, NY, USA), penicillin (100 U/ml) and streptomycin (100 µg/ml), and maintained at 37°C with CO2 in a humidified atmosphere.

Cell growth inhibition test

Inhibition of cell growth was determined by MTT assay. A172 cells (1.0×104 cells/well) were seeded into 96-well culture plates (Nunc, Roskilde, Denmark). After 24 h of incubation, different concentrations of PAB were added to the plates, and 0 µM PAB was used as a control, and other doses as samples. Following incubation, cell growth was measured at different time points by addition of 20 µl MTT (5 mg/ml) at 37°C for 2 h, and DMSO (150 µl) was added to dissolve the formazan crystals. Absorbance was measured at 492 nm with an enzyme-linked immunosorbent assay plate reader (Bio-Rad, Hercules, CA, USA). The percentage of inhibition was calculated as follows:

Cell death (%) = [A492 (control) - A492(sample)]/A492 (control) × 100%

Microtubule aggregation by fluorescence staining

A172 cells (5×105) were placed on a coverslip in a 6-well plate. After 24 h of cell culture, they were treated with 4 µM PAB for 24 or 48 h, and then washed with PBS, fixed in 3.7% formaldehyde, and then rinsed three times in 1X PBS. Next, 0.8% Triton X-100 was added for 15 min, and 5 µg/ml phalloidin-tetramethylrhodamine B isothiocyanate staining was performed for 40 min, followed by one rinse in 1X PBS and then staining with 5 mg/l Hoechst 33258 for 30 min. The intensity of red staining was measured by fluorescence microscopy at excitation wavelength 584 nm with emission filter 607 nm (Leica, Nusslich, Germany). Nuclear changes were observed by fluorescence microscopy at excitation wavelength 350 nm with emission filter 460 nm (Leica).

Cell migration

A172 cells were cultured for 24 h, and then a line was scratched randomly with a pipette tip. Lines with the same width were chosen, and the width was recorded at 0, 12, 24, 36 and 48 h after control medium or PAB treatment by phase contrast microscopy (Leica).

Flow cytometric analysis of cell cycle distribution

A172 cells were cultured for 24 h, and then collected at 0, 12, 24, 36 and 48 h after control medium or PAB treatment. Collected A172 cells (1.0×106) were harvested and rinsed with PBS. The cell pellets were fixed in 70% ethanol at 4°C overnight. After washing twice with PBS, the cells were stained with 1.0 ml of PI solution containing PI 50 mg/l, RNase A 1 g/l and 0.1% Triton X-100 in sodium citrate 3.8 mmol/l, followed by incubation on ice in the dark for 30 min. The samples were analyzed by a FACScan flow cytometer (Becton-Dickinson, Franklin Lakes, NJ, USA).

Quantitative real-time PCR

RNA was extracted from cells treated with control medium and PAB using TRIzol reagent (Gibco-BRL, Rockville, MD, USA) and isolated as specified by the manufacturer. The RNA was treated with DNAse (DNase I-RNase-Free; Ambion, Foster City, CA, USA) to remove any contaminating DNA; 200 ng of total RNA was reverse-transcribed with oligo-dT primers using the High Capacity cDNA RT kit (Applied Biosystems, Foster City, CA, USA) in a 20 µl cDNA reaction, as specified by the manufacturer. For quantitative PCR, the template cDNA was added to a 20 µl reaction with SYBR-Green PCR Master Mix (Applied Biosystems) and 0.2 µM of the primers was added (primers are listed in Table I). Amplification was carried out using an ABI PRISM 7000 for 40 cycles under the following conditions: initial denaturation at 95°C for 10 min, plus 40 cycles of 95°C for 15 sec, followed by 60°C for 1 min. The fold changes were calculated relative to GAPDH using the ΔΔCt method for target gene mRNA analysis.

Table I.

Primers for real-time PCR.

Table I.

Primers for real-time PCR.

Primer pairRoleForward sequence 5′-3′Reverse sequence 5′-3′
Cyclin EReal-time TCAGGGTATCAGTGGTGCGA CAAATCCAAGCTGTCTCTGTG
CDK2Real-time CTCCTGGGCTCGAAATATTATTCCACAG CCGGAAGAGCTGGTCAATCTCAGA
Cyclin AReal-time GCATGTCACCGTTCCTCCTT CAGGGCATCTTCACGCTCTAT
CDK6Real-time GGTCAGGTTGTTTGATGTGTGC TATCCTTTATGGTTTCAGTGGG
Cyclin DReal-time CTACTACCGCCTCACACGCTTC TCCTCCTCCTCTTCCTCCTCCT
CDK1Real-time TCAAGTGGTAGCCATGAAAAAA TAACCTGGAATCCTGCATAAGC
Cyclin B1Real-time TGGCCTCACAAAGCACATGA GCTGTGCCAGCGTGCTAATC
GAPDHReal-time GCAAATTCCATGGCACCGT TCGCCCCACTTGATTTTGG
Observation of morphologic changes by light microscopy

A172 cells (5×105 cells/well) were cultured into a 6-well plate for 12 h. Then, the cells were treated with 4 µM PAB and/or caffeine for 0, 12, 24, 36 and 48 h, and morphologic changes were observed by phase contrast microscopy (Leica).

Western blot analysis of protein expression

A172 cells (1×106) were cultured in a 25-ml culture bottle for the indicated time, and then were treated with 4 µM PAB for the indicated time. Both adherent and floating cells were collected and frozen at −80°C. Western blot analysis was performed for total proteins as described previously (5). Protein expression was detected using primary polyclonal antibody (1:1,000) followed by a corresponding AP-conjugated secondary antibody diluted 1:1,000. Proteins were visualized using NBT and BCIP.

Statistical analysis

All data represent at least three independent experiments, and are expressed as mean ± SD. P-values <0.001 were considered to represent statistically significant differences.

Results

Inhibitory effect of PAB on A172 cells

To detect the inhibitory effect of PAB on neuroglioma cell proliferation, MTT assay was carried out. PAB treatment had an inhibitory effect on the A172 cells in a time- and dose-dependent manner (Fig. 1). In addition, 4 µM PAB inhibited cell growth with an inhibitory ratio of 40% at 48 h, as found in previous studies (5,6). Thus, we chose 4 µM PAB in the following experiments.

Figure 1.

The inhibitory effect of different doses of pseudolaric acid B (PAB) on A172 cell growth at different times. The cells (1×104 cells/well) were incubated with DMEM for 24 h, and then DMEM was replaced with different doses of PAB for 12, 24, 36 and 48 h. Growth inhibition was evaluated by MTT assay. Mean ± SD, n=3.

PAB promotes the aggregation of microtubule fiber

PAB exerts its function by influencing microtubule fiber aggregation (17). We found that PAB treatment promoted the uneven aggregation of microtubule fibers with more obvious red staining, while control cells showed even aggregation of microtubule fibers (Fig. 2). Therefore, PAB influenced cell microtubule fiber to exert its function.

Figure 2.

Tubulin distribution analysis in pseudolaric acid B (PAB)-treated A172 cells by fluorescence microscopy. A172 cells were treated with 4 µM of PAB for 24 and 48 h. Tubulin distribution and nuclear alteration analysis of PAB-treated A172 cells were assessed by fluorescence microscopy after phalloidin-tetramethylrhodamine B isothiocyanate and Hoechst 33258 staining. Merged images of tubulin and DNA are shown. Data are representative of three individual experiments (n=3). Con, control. Scale bar, 15 µm.

PAB inhibits cell migration

Tumor cells with a high ability for migration are difficult to treat. In the migration assay, we confirmed that A172 cells had a high migration ability since with increasing time the scratch wound line disappeared. Meanwhile, after PAB treatment, the scratch wound line that remained was wider than that of the control cells (Fig. 3). Therefore, A172 cells had a high ability of migration, and PAB inhibited the cell migration of these cells.

Figure 3.

Pseudolaric acid B (PAB) inhibits cell migration. We used a pipette to scratch an arbitrary line in the control and PAB-treated cells, and at 12, 24, 36 and 48 h, the width was recorded. Data are representative of three individual experiments (n=3). Con, control.

PAB induces G2/M cell cycle arrest

It was observed that from 12 h, PAB treatment induced obvious G2/M cell cycle arrest. At 24 h, in the control group, the percentage of cells in the G2/M phases was 3.70±1.47%, while after PAB treatment it was 45.82±0.64%; at 36 h in the control group, the percentage of cells was 2.97±1.10%, while after PAB treatment it was 64.83±4.27%; at 48 h in the control group the percentage of cells was 3.45±1.29%, while after PAB treatment it was 56.98±2.14% (Fig. 4A). Therefore, PAB induced G2/M arrest. In addition, at 24 h after PAB treatment the percentage of cells in the G0/G1 phase was 4.50±3.98%, while at 36 h after PAB treatment the percentage of G0/G1 cells was 8.39±1.46%, and at 48 h after PAB treatment the percentage of S phase cells (34.65±2.82%) was increased compared to the PAB group at 36 h (26.77±3.36%). Therefore, PAB induced cell cycle slippage from G2/M into G0/G1 and then into S phase. To further investigate the mechanism underlying the effect on the cell cycle by PAB, cyclin B1 and CDK1 expression was detected owning to the fact that the cyclin B1/CDK1 complex regulates G2/M process. It was found that from 12 h, the expression of cyclin B1 was increased after PAB treatment compared to the control treatment, and the expression of CDK1 was increased from 24 h, while at 48 h, the expression of CDK1 and cyclin B1 after PAB treatment was not increased compared to the control treatment (Fig. 4B). Therefore, PAB by regulating cyclin B1/CDK1 complex expression induced cell cycle arrest at G2/M until 36 h, and at 48 h cyclin B1/CDK1 complex expression was consistent with the cell cycle slippage. To explain the expression alteration of the cyclin B1/CDK1 complex, the transcription of this complex was analyzed. It was found that the mRNA level of cyclin B1 in the PAB group was 5.39 times higher than that in the control group after a 12-h treatment (P<0.01), while at 48 h, there was no obvious difference. For CDK1, at 12 and 48 h after PAB treatment, there was no difference with the control treatment (Fig. 4C). Therefore, PAB regulated protein expression through different mechanisms, partly through the transcriptional level.

Figure 4.

Pseudolaric acid B (PAB) promotes cell cycle arrest. (A) At 12, 24, 36 and 48 h, PAB induced obvious cell cycle arrest. Flow cytometric analysis showed that from 12 to 48 h, 4 µM PAB induced obvious cell cycle arrest. Mean ± SD, n=3. (B) PAB regulated cyclin B1 and CDK1 expression. At 12 and 48 h after PAB treatment, the cells were analyzed and western blotting was performed for protein expression. Actin is shown as a loading control. The number above each western blot band is provided, which were standardized using actin and normalized to 1.0 in the control group. C, control; P, PAB. (C) At 12 and 48 h after PAB treatment, intracellular cyclin B1 and CDK1 mRNA levels were detected in the control group (con) or PAB treatment group by real-time quantitative PCR. The results were standardized using GAPDH mRNA as a control and normalized to 1.0 in the control group. The results represent the mean ± SD of three independent experiments; **P<0.01.

Meanwhile, the effect of PAB on S phase and G0/G1-related protein expression was observed. It was found that in regards to S phase-related proteins, PAB decreased the expression of cyclin E at 24 and 36 h after PAB treatment, but at 48 h PAB treatment increased the expression of cyclin E, and PAB decreased the expression of CDK2 from 12 to 36 h after PAB treatment, but at 48 h, PAB treatment had no effect on CDK2 expression (Fig. 5A), which was consistent with the slippage into S phase at 48 h after PAB treatment. However, PAB treatment had no effect on the expression of cyclin A from 12 to 48 h compared to control treatment (Fig. 5A), indicating that PAB regulated cell cycle progression, possibly independent of cyclin A expression. In addition, we also assessed the transcription of them to explain the alteration at the protein level, and we found that the mRNA level of CDK2 was decreased after PAB treatment at 12 h compared to the control treatment, and the mRNA level of cyclin E was increased after PAB treatment at 48 h compared to the control treatment, which could partly explain the alteration of CDK2 and cyclin E (Fig. 5C). For G0/G1-related protein expression, it was found that at 36 h after PAB treatment, the expression of cyclin D was increased, but at 48 h, the expression of cyclin D was decreased (Fig. 5B), which was consistent with the slippage into S phase at 36 h, and then into S phase at 48 h after PAB treatment. The expression of CDK6 was not affected when compared to the control treatment (Fig. 5B), indicating that PAB regulated cyclin D expression to regulate the activity of cyclin D and CDK6 complex. In addition, at 12 and 48 h, PAB did not affect the mRNA levels of cyclin D and CDK6 compared to the levels noted in the control treatment group (Fig. 5C). Therefore, PAB regulates protein expression, but not at the level of transcription.

Figure 5.

Pseudolaric acid B (PAB) regulates expression of S and G0/G1 phase-related proteins. (A and B) At 12 and 36 h after PAB treatment, the cells were analyzed and western blotting was performed for cyclin A1, cyclin E1, CDK2, cyclin D1 and CDK6 protein expression. Actin is shown as a loading control. The number above each western blot band is provided, which was standardized using actin and normalized to 1.0 in the control group. C, control; P, PAB. (C) At 12 and 48 h after PAB treatment, intracellular cyclin A1 and E1, CDK2, cyclin D1 and CDK6 mRNA levels were detected in the control group (Con) or PAB treatment group by real-time quantitative PCR. The results were standardized using GAPDH mRNA as a control and normalized to 1.0 in the control group. The results represent the mean ± SD of three independent experiments; ***P<0.001.

PAB induces cell death through MAPK protein

To further confirm the mechanism underlying the inhibition of cell proliferation by PAB, in the present study we confirmed the effect of PAB on cell death. From morphologic analysis, it was found that from 12 h, compared to the control group, the cell number was decreased by PAB treatment. Meanwhile it was found that in the PAB treatment group, the number of floating cells was increased compared to the number noted in the control group, indicating that PAB induced cell death (Fig. 6A). Then, we further analyzed the mechanism of cell death, and it was confirmed that from 12 to 48 h, the expression levels of JNK and ERK were decreased by PAB treatment compared to these levels in the control treatment group, while the expression of p38 was increased by PAB (Fig. 6B). Therefore, by regulating the expression of MAPK, PAB induced cell death in the A172 cells.

Figure 6.

Pseudolaric acid B (PAB) induces cell death through MAPK protein. (A) After 12, 24, 36 and 48 h of PAB treatment, morphological changes in A172 cells were visualized under phase contrast microscopy; Scale bar, 100 µm. (B) Expression of MAPK protein. Actin is shown as a loading control. The number above each western blot band is provided, which was standardized using actin and normalized to 1.0 in the control group. C, control; P, PAB. Data are representative of three individual experiments (n=3).

PAB induces cell death through the DNA damage response

Cell death and cell cycle arrest usually are downstream of the DNA damage response (10). In the present study, we found that PAB induced cell death and cell cycle arrest, and we aimed to ascertain whether PAB induces a DNA damage response. Thus, the expression of γH2AX, which is the marker of DNA damage response, was determined. It was found that PAB treatment increased the expression of γH2AX at 12, 24, 36 and 48 h compared to the expression levels noted in the control treatment group (Fig. 7A). Then, we analyzed the effect of caffeine on the inhibitory ratio of PAB, and it was found that at 24 h, caffeine treatment decreased the inhibitory ratio from 35.90±5.67 to 26.38±2.52%, and at 48 h caffeine treatment decreased the inhibitory ratio from 44.12±3.56 to 21.79±1.89%. Therefore, PAB activated the DNA damage response to induce apoptosis (Fig. 7B). Subsequently, caffeine was used to inhibit the DNA damage response, and it was found that 2 mM caffeine treatment inhibited cell death induced by PAB at 24 h and 48 h compared to that noted in the PAB treatment group (Fig. 7C).

Figure 7.

Pseudolaric acid B (PAB) induces DNA damage response for cell death. (A) The expression of γ-H2AX protein after 0, 12, 24, 36 and 48 h of PAB treatment. Histone is shown as a loading control. The number above each western blot band is provided, which was standardized using histone and normalized to 1.0 in the control group. Data are representative of three individual experiments (n=3). (B) The effect of caffeine, an inhibitor of DNA damage response, on cell death induced by PAB in A172 cells at 24 and 48 h as evaluated by MTT method. Mean ± SD, n=3; ***P<0.001. (C) After 24 and 48 h of PAB and/or 2 mM caffeine treatment morphological changes were visualized in A172 cells under phase contrast microscopy; Scale bar, 50 µm. C, control; P, PAB; Caff, caffeine.

Discussion

Glioblastoma is the most common cancer of the brain and displays an increasing incidence. Despite major advances in the field, there is no curative therapy for glioblastoma, to date (18). Pseudolaric acid B (PAB), a diterpene acid isolated from the root and trunk bark of Pseudolarix kaempferi Gordon was found to exert antitumor effect on different cell lines (1–6), and in the present study we explored the role of PAB in glioblastoma.

Firstly, we found that PAB inhibited glioblastoma cell growth in a time- and dose-dependent manner, indicating that PAB had potential anti-glioblastoma function. Similar to the role of PAB in other cell lines (17,19,20), PAB mainly affected microtubule aggregation in glioblastoma to inhibit cancer cell growth. It has been reported that glioblastoma cell migration and invasion occur at multiple stages of cancer progression and are a clinical obstacle for therapy. Thus, suppression of glioblastoma cell migration and invasion may provide an effective therapeutic strategy (21). The present study confirmed that PAB inhibited the migration of glioblastoma, which is another advantage of PAB in the course of antitumor therapy.

Cell cycle arrest is an important mechanism by which to inhibit cell growth. We found that from 12 h, PAB treatment obviously increased the percentage of cells in the G2/M phase compared to the percentage in the control treatment group, indicating that PAB had the ability to induce cell cycle arrest to inhibit cell growth. In addition, PAB treatment increased the expression of cyclin B1/CDK1 complex expression, which was consistent with the profile of G2/M arrest. Meanwhile, PAB treatment increased the mRNA level of cyclin B1 at 12 h, indicating that PAB affected cyclin B1 transcription to regulate protein expression, and PAB did not affect CDK1 transcription, indicating that PAB regulated protein expression through different mechanisms. Meanwhile it was noted that at 36 h after PAB treatment, the percentage of G0/G1 phase cells was increased compared to 24 h after PAB treatment, and at 48 h after PAB treatment, the percentage of S phase cells was increased compared to 36 h after PAB treatment, indicating that at 36 h, cell cycle slippage into G0/G1 occurred, and at 48 h cell cycle slippage into S occurred. Furthermore, expression levels of cell cycle-related G0/G1 and S phase proteins were observed, and it was found that at 36 h after PAB treatment, the expression of cyclin D1 was increased compared to that in the control treatment group, and at 48 h, the expression of cyclin E and CDK2 was increased compared to levels in the control treatment group, which was consistent with the results of cell cycle slippage.

Cell death is another mechanism of inhibiting cell growth. In the present study, based on morphologic analysis, we found that PAB treatment promoted cell death with increasing time, and PAB treatment inhibited the expression of JNK and ERK, and increased the expression of p38 compared to levels in the control treatment group. Therefore, PAB regulated corresponding protein expression to induce cell death. Meanwhile DNA damage response is commonly activated to promote cell death. We found that PAB treatment increased the expression of γ-H2AX, which is the marker of DNA damage response. Therefore, PAB treatment activated the DNA damage response. In addition, caffeine was used by us to inhibit the DNA damage response. We found that caffeine reversed the effect of PAB to protect cells from cell death, and correspondingly to decrease the inhibitory ratio; thus PAB activated the DNA damage response to induce cell death, which provided a target to increase the antitumor effect of PAB. In conclusion, PAB is a candidate for anti-glioblastoma treatment.

Acknowledgements

The present study was supported by funding from the National Natural Science Foundation of China (no. 81301416), the Postdoctoral Science Foundation of China (nos. 2014M561302 and 2015T80299), the Norman Bethune Program of Jilin University (no. 2015202), the Jilin Provincial Science and Technology Department (nos. 20140204004YY and 20160414025GH), and the Department of Human Resources and Social Security of Jilin Province (no. 2016014).

References

1 

Gong X, Wang M, Tashiro S, Onodera S and Ikejima T: Involvement of JNK-initiated p53 accumulation and phosphorylation of p53 in pseudolaric acid B induced cell death. Exp Mol Med. 38:428–434. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Gong XF, Wang MW, Tashiro S, Onodera S and Ikejima T: Pseudolaric acid B induces apoptosis through p53 and Bax/Bcl-2 pathways in human melanoma A375-S2 cells. Arch Pharm Res. 28:68–72. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Pan DJ, Li ZL, Hu CQ, Chen K, Chang JJ and Lee KH: The cytotoxic principles of Pseudolarix kaempferi: Pseudolaric acid-A and -B and related derivatives. Planta Med. 56:383–385. 1990. View Article : Google Scholar : PubMed/NCBI

4 

Yu J, Li X, Tashiro S, Onodera S and Ikejima T: Bcl-2 family proteins were involved in pseudolaric acid B-induced autophagy in murine fibrosarcoma L929 cells. J Pharmacol Sci. 107:295–302. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Yu JH, Cui Q, Jiang YY, Yang W, Tashiro S, Onodera S and Ikejima T: Pseudolaric acid B induces apoptosis, senescence, and mitotic arrest in human breast cancer MCF-7. Acta Pharmacol Sin. 28:1975–1983. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Yu JH, Wang HJ, Li XR, Tashiro S, Onodera S and Ikejima T: Protein tyrosine kinase, JNK, and ERK involvement in pseudolaric acid B-induced apoptosis of human breast cancer MCF-7 cells. Acta Pharmacol Sin. 29:1069–1076. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Shakur SF, Bit-Ivan E, Watkin WG, Merrell RT and Farhat HI: Multifocal and multicentric glioblastoma with leptomeningeal gliomatosis: A case report and review of the literature. Case Rep Med. 2013:1326792013. View Article : Google Scholar : PubMed/NCBI

8 

Walker C, Baborie A, Crooks D, Wilkins S and Jenkinson MD: Biology, genetics and imaging of glial cell tumours. Br J Radiol. 84:S90–S106. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Parsons DW, Jones S, Zhang X, Lin JC, Leary RJ, Angenendt P, Mankoo P, Carter H, Siu IM, Gallia GL, et al: An integrated genomic analysis of human glioblastoma multiforme. Science. 321:1807–1812. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Lozano G and Elledge SJ: p53 sends nucleotides to repair DNA. Nature. 404:24–25. 2000. View Article : Google Scholar : PubMed/NCBI

11 

Li FF, Yi S, Wen L, He J, Yang LJ, Zhao J, Zhang BP, Cui GH and Chen Y: Oridonin induces NPM mutant protein translocation and apoptosis in NPM1c+ acute myeloid leukemia cells in vitro. Acta Pharmacol Sin. 35:806–813. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Qi M, Yao G, Fan S, Cheng W, Tashiro S, Onodera S and Ikejima T: Pseudolaric acid B induces mitotic catastrophe followed by apoptotic cell death in murine fibrosarcoma L929 cells. Eur J Pharmacol. 683:16–26. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Klekotka PA, Santoro SA, Wang H and Zutter MM: Specific residues within the alpha 2 integrin subunit cytoplasmic domain regulate migration and cell cycle progression via distinct MAPK pathways. J Biol Chem. 276:32353–32361. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Xia Z, Dickens M, Raingeaud J, Davis RJ and Greenberg ME: Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science. 270:1326–1331. 1995. View Article : Google Scholar : PubMed/NCBI

15 

Yoon S and Seger R: The extracellular signal-regulated kinase: Multiple substrates regulate diverse cellular functions. Growth Factors. 24:21–44. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Hartwell LH and Weinert TA: Checkpoints: Controls that ensure the order of cell cycle events. Science. 246:629–634. 1989. View Article : Google Scholar : PubMed/NCBI

17 

Yu J, Ren P, Zhong T, Wang Y, Yan M, Xue B, Li R, Dai C, Liu C, Chen G, et al: Pseudolaric acid B inhibits proliferation in SW579 human thyroid squamous cell carcinoma. Mol Med Rep. 12:7195–7202. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Liu X, Chong Y, Tu Y, Liu N, Yue C, Qi Z, Liu H, Yao Y, Liu H, Gao S, et al: CRM1/XPO1 is associated with clinical outcome in glioma and represents a therapeutic target by perturbing multiple core pathways. J Hematol Oncol. 9:1082016. View Article : Google Scholar : PubMed/NCBI

19 

Tong YG, Zhang XW, Geng MY, Yue JM, Xin XL, Tian F, Shen X, Tong LJ, Li MH, Zhang C, et al: Pseudolarix acid B, a new tubulin-binding agent, inhibits angiogenesis by interacting with a novel binding site on tubulin. Mol Pharmacol. 69:1226–1233. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Wong VK, Chiu P, Chung SS, Chow LM, Zhao YZ, Yang BB and Ko BC: Pseudolaric acid B, a novel microtubule-destabilizing agent that circumvents multidrug resistance phenotype and exhibits antitumor activity in vivo. Clin Cancer Res. 11:6002–6011. 2005. View Article : Google Scholar : PubMed/NCBI

21 

Liu B, Dong H, Lin X, Yang X, Yue X, Yang J, Li Y, Wu L, Zhu X, Zhang S, et al: RND3 promotes Snail 1 protein degradation and inhibits glioblastoma cell migration and invasion. Oncotarget. 7:82411–82423. 2016.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Song F, Yu X, Zhang H, Wang Z, Wang Y, Meng X and Yu J: Pseudolaric acid B inhibits neuroglioma cell proliferation through DNA damage response. Oncol Rep 38: 2211-2218, 2017.
APA
Song, F., Yu, X., Zhang, H., Wang, Z., Wang, Y., Meng, X., & Yu, J. (2017). Pseudolaric acid B inhibits neuroglioma cell proliferation through DNA damage response. Oncology Reports, 38, 2211-2218. https://doi.org/10.3892/or.2017.5861
MLA
Song, F., Yu, X., Zhang, H., Wang, Z., Wang, Y., Meng, X., Yu, J."Pseudolaric acid B inhibits neuroglioma cell proliferation through DNA damage response". Oncology Reports 38.4 (2017): 2211-2218.
Chicago
Song, F., Yu, X., Zhang, H., Wang, Z., Wang, Y., Meng, X., Yu, J."Pseudolaric acid B inhibits neuroglioma cell proliferation through DNA damage response". Oncology Reports 38, no. 4 (2017): 2211-2218. https://doi.org/10.3892/or.2017.5861
Copy and paste a formatted citation
x
Spandidos Publications style
Song F, Yu X, Zhang H, Wang Z, Wang Y, Meng X and Yu J: Pseudolaric acid B inhibits neuroglioma cell proliferation through DNA damage response. Oncol Rep 38: 2211-2218, 2017.
APA
Song, F., Yu, X., Zhang, H., Wang, Z., Wang, Y., Meng, X., & Yu, J. (2017). Pseudolaric acid B inhibits neuroglioma cell proliferation through DNA damage response. Oncology Reports, 38, 2211-2218. https://doi.org/10.3892/or.2017.5861
MLA
Song, F., Yu, X., Zhang, H., Wang, Z., Wang, Y., Meng, X., Yu, J."Pseudolaric acid B inhibits neuroglioma cell proliferation through DNA damage response". Oncology Reports 38.4 (2017): 2211-2218.
Chicago
Song, F., Yu, X., Zhang, H., Wang, Z., Wang, Y., Meng, X., Yu, J."Pseudolaric acid B inhibits neuroglioma cell proliferation through DNA damage response". Oncology Reports 38, no. 4 (2017): 2211-2218. https://doi.org/10.3892/or.2017.5861
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team