Homeobox containing 1 inhibits liver cancer progression by promoting autophagy as well as inhibiting stemness and immune escape

  • Authors:
    • Hengli Zhao
    • Huifeng Jia
    • Qiuju Han
    • Jian Zhang
  • View Affiliations

  • Published online on: July 10, 2018     https://doi.org/10.3892/or.2018.6551
  • Pages: 1657-1665
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Homeobox containing 1 (HMBOX1) is a novel transcription repressor that is significantly downregulated in human liver cancer tissues and cell lines, but the exact biological function of HMBOX1 in liver cancer is still unknown. We observed a negative association between HMBOX1 expression level and the clinical stages of liver cancer. HMBOX1 also increased the LC3 II/LC3 I ratio, the endogenous autophagy marker, and inhibited the p38/AKT/mTOR pathway. Furthermore, cancer stem cell specific genes, including CD133, KLF4, ESG1 and SOX2, were significantly downregulated upon HMBOX1 overexpression. Finally, the susceptibility of HepG2 cells to NK cell‑mediated cytolysis was increased by HMBOX1 overexpression and weakened by siRNA‑mediated inhibition of HMBOX1. All these findings indicated that HMBOX1 expression in hepatocytes could protect against the progression of liver cancer, and the underlying mechanisms may include promoting autophagy, inhibiting CSC phenotype and increasing the sensitivity of tumor cells to NK cell cytolysis. Therefore, HMBOX1 may be useful for developing new treatments for liver cancer.

Introduction

Liver cancer, including hepatocellular carcinoma (HCC) and cholangiocarcinoma (CCA) in adults, and hepatoblastoma (HB) mainly in children, is one of the most malignant tumor types with poor response to drugs used at present against cancer (14). Traditional treatments for liver cancer include surgery, radiofrequency ablation and chemotherapy. However, liver cancer is usually diagnosed at an advanced stage and the patients therefore miss the opportunity for surgical resection. Systemic chemotherapy via or trans-arterial chemoembolization is the second line of treatment, but the overall response rate is rather low due to the high chemoresistance of liver cancer cells (5,6). Therefore, dissecting the underlying mechanisms of liver cancer development and progression is essential for developing new therapeutic drugs and strategies.

HMBOX1 (homeobox containing 1), a novel human homeobox gene, was first isolated from the human pancreatic cDNA library. HMBOX1 has the atypical homeobox domain with 78 amino acids and a putative HNF1-N domain, and is classified into the HNF homeobox class of the Hmbox family (79). Recently, several studies have reported the possible biological functions of HMBOX1. Su et al demonstrated that HMBOX1 was the key factor in the differentiation of bone marrow stromal cells (BMSCs) to endothelial cells (ECs) by regulating IP-10 and Ets-1 (10). Ma et al reported that HMBOX1 regulated intracellular free zinc levels by interacting with MT2A, inhibiting apoptosis and promoting autophagy of VECs (11). In addition, HMBOX1 could directly bind to telomeric double-stranded DNA and helped in telomere maintenance in cells with ALT (alternative lengthening of telomeres) (12).

In our previous study, we found that HMBOX1 acted as a transcriptional repressor of interferon γ (IFN-γ) in natural killer (NK) cells (13,14). Furthermore, HMBOX1 was localized in both the cytoplasm and nucleus, and distributed widely in many tissues, including the liver. Notably, HMBOX1 was expressed in significantly lower levels in hepatic carcinoma tissues compared to adjacent healthy tissues (8,15). Therefore, HMBOX1 may play a role in the progression of liver cancer, although the exact biological function of HMBOX1 in liver cancer is still unknown.

In this study, we demonstrated that the expression level of HMBOX1 was negatively associated to the differentiation degree and clinical stage of liver cancer. Furthermore, we also revealed that HMBOX1 could significantly enhance autophagy and downregulate the ‘stemness’ genes in liver cancer cells. Notably, HMBOX1 overexpression increased the sensitivity of tumor cells to NK cell cytolysis and increased NK function. These results indicated that HMBOX1 may be a novel therapeutic target for human liver cancer that is worth investigating.

Materials and methods

Cell lines and cell culture

The human natural killer cell line NK-92 was purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in a-MEM supplemented with 12.5% horse serum (both from Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), 12.5% fetal bovine serum (FBS), 100 U/ml rhIL-2, 0.1 mM P-mercaptoethanol and 0.02 mM folic acid. Human liver cancer cell line HepG2 (HCC/HB) (16), human hepatoma cell line PLC/PRF/5, human immortalized liver cell line HL7702 and murine hepatoma cell line Hepa1-6 were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China) and maintained in RPMI-1640 medium supplemented with 10% FBS. All these cell lines were conserved in our laboratory.

Liver cancer specimens

Paraffin sections from 14 liver specimens of liver cancer patients, including 10 males and 4 females with the age of 54.6±4.9 years old, were procured from Qilu Hospital of Shandong University (Jinan, China) and written informed consents were obtained from all patients. The samples were collected from July 2014 to May 2015, and all of them were processed for routine histological examination and were classified by their degree of differentiation (poorly, moderately and well-differentiated) and clinical stage (I to III). The use of the liver specimens was approved by the Ethics Committee of Qilu Hospital of Shandong University and was consistent with the standards established by the Declaration of Helsinki (as revised in Fortaleza, Brazil, October 2013).

Animal model

Dimethylnitrosamine (DEN, 25 mg/kg) were injected intraperitoneally into 2-week-old male C57BL/6 mice (n=10, 6.0–6.5 g) once a week for three times total, followed by 500 µl/kg Carbon tetrachloride (CCL4) once a week for 12 times total. Mice at 42 weeks old were anesthetized by lidocaine (100 mg/kg) intraperitoneally. Mice with visible tumors (≥0.5 mm) on the surface of the liver were used in this study. Tumor tissues and age-matched healthy liver tissues were collected and either fixed in 4% paraformaldehyde for further analysis.

Animal experiment protocols were approved by the Ethics Committee of Shandong University. Mice were housed in a temperature-controlled pathogen-free environment on a 12-h light/12-h dark cycle, and had access to food and water ad libitum.

Immunohistochemistry

After preconditioning, the sections were incubated overnight with a primary antibody in a humidified chamber at 4°C. Anti-HMBOX1 mAb (dilution 1:100; cat. no. 2A5F4 mAb) as previously described (8) was used as the primary HMBOX1 antibody. After washing with PBS, the sections were incubated with anti-mouse secondary antibody with no dilution (cat. no. SP-9002; Zsbio, Beijing, China) for 30 min at 37°C. The sections were washed again with phosphate-buffered saline (PBS) and stained with DAB solution (Zsbio) according to the manufacturer's protocol, and the nuclei were dyed with hematoxylin. PBS was used in place of the primary antibody as a negative control.

Immunofluorescence

HepG2 cells transfected with pEGFP-N1-HMBOX1 or siRNA-HMBOX1 were cultured in 96-well plates for 6 h. After a 30-min fixation with 1% paraformaldehyde, the cells were blocked with 5% BSA at room temperature and incubated overnight with an LC3B antibody (dilution 1:500; cat. no. 2775; Cell Signaling Technology, Danvers, MA, USA) in a humidified chamber at 4°C. The cells were then washed with PBS and incubated with an anti-rabbit secondary antibody (dilution 1:200; cat. no. 8889; Cell Signaling Technology) for 1 h at 37°C in the dark. The nuclei were counterstained with DAPI and fluorescently-labeled cells were visualized at the requisite excitation wavelength (LC3B: 594 nm; DAPI: 340 nm) under a fluorescence microscope (Olympus TH4-200; Olympus Corp., Tokyo, Japan) at ×400 magnification

Transfection and RNA interference

Cells were transfected with either specific siRNA against HMBOX1 or the negative control using Lipofectamine™ 2000 (Invitrogen Life Technologies; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The siRNAs (Target sequence: GGAAGTTCATATGGGAATA) were designed and synthesized by Guangzhou RiboBio Co., Ltd. (Guangzhou, China).

Cytotoxicity assay

The cytotoxic activity of NK-92 cells against HepG2 cells was assessed by MTT assay. HepG2 cells transfected with different plasmids were seeded in 96 well plates at 1×104 cells/well 24 h after transfection. NK92 cells were added at a ratio of 10:1, 5:1 or 2.5:1, and incubated for an additional 6 h. MTT (Sigma-Aldrich, Merck; St. Louis, MO, USA) solution was prepared at 10 mg/ml and 20 µl was added to the medium. The cells were incubated for another 4 h and the absorbance was determined at 570/630 nm using a multifunctional microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The percentage of cytotoxicity was calculated by the formula: lysis (%) = 1 - (ODE+T - ODE)/ODT × 100%; E, effector cell group; T, target cell group; E+T, effector cell group and target cell group.

Quantitative real-time PCR analysis

Total RNA was extracted from cells using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and used to synthesize cDNA using M-MLV Reverse Transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.) in accordance with the manufacturer's protocol.

The specific transcripts were detected via Real-time PCR (qRT-PCR) with SYBR Green Master Mix (Toyobo, Osaka, Japan) using an iCycleriQ Real-Time PCR system (Bio-Rad Laboratories, Inc.). The expression of specific transcripts was normalized to GAPDH levels. The qRT-PCR began with a step of denaturation (95°C for 25 sec), annealing (60°C for 20 sec) and extension (72°C for 30 sec) by 35 cycles. For the conventional RT-PCR, it began with a step of denaturation (95°C for 30 sec), annealing (60°C for 30 sec) and extension (72°C for 60 sec) by 35 cycles, and the production was separated by Gel electrophoresis (1.5%) with ethidium bromide. ImageJ software (version 1.4.3.67; National Institutes of Health, Bethesda, MD, USA) was used for densitometry analysis. Forward and reverse primers were shown in Table 1.

Table I.

Sequences of forward and reverse primers.

Table I.

Sequences of forward and reverse primers.

GeneSquence of primers (5′-3′)
HMBOX1Forward: AACCCTGGCGCTACACTAAG
Reverse: TCCTTTCTCCAGGTAAATCGAC
CD133Forward: ACATGAAAAGACCTGGGGG
Reverse: GATCTGGTGTCCAGCATG
Klf4Forward: GCGGCAAAACCTACACAAAG
Reverse: CCCCGTGTGTTTACGGTAGT
NANOGForward: TTTGTGGGCCTGAAGAAAACT
Reverse: AGGGCTGTCCTGAATAAGCAG
Sox2Forward: GCGAACCATCTCTGTGGTCT
Reverse: GGAAAGTTGGGATCGAACAA
ESGForward: GCGCAGTATCACAGCCTTAAA
Reverse: TCAATCTCTTGGCGATTTCA
APOA1BPForward: TTCAGCGTGGACCAACTTATG
Reverse: GGCCTTTTGGGGTAATAGATGG
CYP2W1Forward: CCGATTTGACTACCGGGACC
Reverse: CGTCCACATAGCTGCACAC
CYP46A1Forward: GTGCGCTCCAGACTGTGTTT
Reverse: CCAGGTCTATGACTCTCCGCT
CYP26B1Forward: TGGACCTCCTCATTGAGAGCA
Reverse: GGCATAGGCCGCAAAGATCA
HPDForward: GAACCTCTAGCCTACAGGGG
Reverse: TCTTTGTTCCAGGGGTTGAGC
FasForward: TCTGGTTCTTACGTCTGTTGC
Reverse: CTGTGCAGTCCCTAGCTTTCC
GAPDHForward: GAAGGTGAAGGTCGGAGT
Reverse: CATGGGTGGAATCATATTGGAA
Western blotting

Total protein was extracted from cells lysed with a RIPA lysis buffer [50 mM Tris-HCl (pH 8.0), 1% NP-40, 0.5% sodium deoxycholate, 150 mM NaCl and 1 mM PMSF], and the concentrations were determined with BSA methods. The proteins (30 µg/lane) were separated by SDS-PAGE on a 10% polyacrylamide gel and then transferred onto polyvinylidene difluoride membranes (PVDF) (EMD Millipore, Billerica, MA, USA). The membranes were blocked with 5% non-fat milk in TBS/0.1% Tween-20 for 1 h at room temperature. Then the protein were probed with specific antibodies (1:1,000): anti-HMBOX1 (cat. no. ab97643; Abcam, Cambridge, UK), anti-p38 and anti-p-p38 (cat. nos. 8690 and 4511; Cell Signaling Technology), anti-AKT and anti-p-AKT (cat. nos. 4685 and 4060; Cell Signaling Technology), anti-mTOR and anti-p-mTOR (cat. nos. ab32028 and ab109268; Abcam), anti-LC3 (cat. no. 2775; Cell Signaling Technology) and β-actin (cat. no. sc-58673; Santa Cruz Biotechnology). The protein were incubated with secondary antibody (dilution 1:1,000; cat. nos. A0216 and A0208; Beyotime Institute of Biotechnology, Shanghai, China) for 1 h at room temperature and the bands were visualized using Immobilon Western Chemiluminescent HRP Substrate (EMD Millipore) and analyzed with Alpha Ease FC software (Bio-Rad Laboratories, Inc.).

Flow cytometry

The cells were phenotypically analyzed by flow cytometry with the following antibodies (1:10): PE-cy5-labeled anti-Fas (cat. no. 556641; BD Pharmingen BD Biosciences, San Diego, CA, USA), PE-conjugated anti-NKG2A (cat. no. FAB1059P; R&D Systems, Minneapolis, MN, USA), FITC-conjugated anti-NKG2D and PE-conjugated anti-PD-L1 (cat. nos. 11-5878-73 and 12-5983-42; eBiosciences, San Diego, CA, USA). The cells were stained with a saturating amount of the antibodies for 1 h at 4°C. After washing with PBS, the stained cells were acquired using a FACS Calibur system (BD Biosciences, San Jose, CA, USA) and analyzed with WinMDI 2.0 software (Scripps Research Institute, La Jolla, CA, USA).

Statistical analyses

All data are presented as the mean ± SD of three or more independent experiments. Statistical significance was calculated using Kruskal Wallis test, post hoc tests (Dunn's test, Mann Whitney U with Bonferroni's correction applied) and Student's t-test. A value of P<0.05 was considered to indicate a statistically significant difference.

Results

HMBOX1 expression is correlated to the differentiation of liver cancer

Our previous study (8) revealed that the expression of HMBOX1 in liver cancer was lower than that in adjacent non-cancerous tissues. To elucidate whether HMBOX1 expression was associated with the development of liver cancer, tissue specimens with varying degrees of differentiation and of different clinical stages were analyzed. As shown in Fig. 1A, HMBOX1 expression revealed a significant negative association with the degree of tumor differentiation (P<0.05) as well as the clinical stage (Fig. 1B). Furthermore, both mRNA and protein levels of HMBOX1 were suppressed in the HepG2 and PLC/PRF/5 cell lines compared to the immortalized HL7702 hepatocyte cell line (Fig. 1C and D). In the mouse liver cancer model induced by DEN and CCL4, liver HMBOX1 expression level was also significantly decreased in cancer tissue compared with normal tissue (Fig. 2A). HMBOX1 expression in the murine Hepa1-6 cell line was also lower than in primary murine hepatocytes (Fig. 2B and C). All these results indicated an important role of HMBOX1 in hepatocarcinogenesis.

HMBOX1 promotes autophagy in liver cancer cells

Autophagy is a common tumor suppression mechanism that prevents cellular damage and maintains cellular homeostasis. To elucidate the function of HMBOX1 on cell autophagy, HepG2 cells were transfected with either HMBOX1 siRNA or pEGFP-N1-HMBOX1 plasmids to suppress or overexpress HMBOX1 respectively. After 48 h of transfection, autophagy was detected by assessing the levels of autophagic protein, microtubule-associated protein 1 light chain 3B (LC3B). As shown in Fig. 3A, the expression of LC3B was increased in HepG2 cells overexpressing HMBOX1. To further validate the effect of HMBOX1 on autophagic flux, HepG2 cells were stimulated with 10 µg/ml lipopolysaccharide (LPS) and the LC3 II/LC3 I ratio was analyzed by western blotting. As shown in Fig. 3B, the LC3 II/LC3 I ratio was upregulated in HMBOX1 overexpressing HepG2 cells, clearly indicating that HMBOX1 promoted autophagy of HepG2 cells.

Mammalian target of rapamycin (mTOR) prevents mammalian cell autophagy (17,18), and is activated by the PI3K/protein kinase B (Akt) pathway kinases and the p38 mitogen-activated protein kinase (MAPK). HMBOX1 overexpression inhibited the phosphorylation of mTOR as well its upstream activators p38MAPK and AKT, indicating a possible underlying mechanism (Fig. 3B). HMBOX1 overexpression also suppressed the levels of pro-inflammatory IL-6, IL-8 and TNF-α (Fig. 3C), along with inhibiting NF-κB activation (Fig. 3D). These results indicated that HMBOX1 could suppress cancer development by upregulating autophagy, which inhibited cancer-associated inflammation.

HMBOX1 inhibits expression of ‘stemness’ genes in liver cancer cells

Considering that HMBOX1 expression is negatively associated to the differentiation of liver cancer, we hypothesized that HMBOX1 may affect the expression of genes regulating stemness and differentiation in liver cancer cells. Cancer stem cells (CSCs) are a subpopulation of tumor cells which resemble normal stem cells with respect to their ability to self-renew and differentiate into multiple cell types (19). CD133, a CSC marker, is related to tumor initiation and progression, as well as colony formation ability and differentiation potential of the cells (13,14). Bahnassy et al reported that increased expression of CD133 in the liver tumor microenvironment promoted liver cancer progression (20). CSCs are also known to endogenously express stemness-related genes like OCT3/4, SOX2, NANOG and KLF4 in many cancers (2123). To investigate whether HMBOX1 contributed to the regulation of stemness-related genes, their expression was analyzed by real-time PCR. As shown in Fig. 4A, the mRNA levels of CD133, KLF4, ESG1 and SOX2 were significantly reduced in HepG2 cells 3 days after pEGFP-N1-HMBOX1 transfection. Contrasting results were observed after HMBOXI silencing, with an increasing tendency of the aforementioned genes level, however, no statistical difference was observed (Fig. 4B).

To gain deeper insights into the regulatory function of HMBOX1 in liver CSCs, mRNA microarray analysis was performed in HepG2 cells overexpressing HMBOX1. A cluster of liver metabolism-related genes was upregulated, including apolipoprotein A-1 binding protein (APOA1BP), cytochrome P450 proteins (CYP2W1, CYP46A1 and CYP26B1) and 4-hydroxyphenylpyruvate dioxygenase (HPD) (Fig. 4C). As anticipated, the mRNA levels of these genes were significantly downregulated upon HMBOX1 silencing (Fig. 4D). These results indicated a potential function of HMBOX1 in reversing the phenotype of liver CSCs to that of normal hepatocytes.

HMBOX1 increases the sensitivity of liver cancer cells to NK cell-mediated cytolysis

NK cells, the major cellular component of innate immunity, predominantly reside in the liver (2428). Several studies have revealed significantly reduced cytotoxicity of NK cells obtained from liver perfusates of liver cancer patients (29), indicating that a functional defect of NK cells is responsible for the failure of antitumor immune responses (30). To elucidate whether HMBOX1 is involved in cancer-induced immune system escape, the human NK-92 cell line was used as the effector cell population. After co-incubation with the target HMBOX1 overexpressing or silencing HepG2 cells, NK cell cytotoxicity was detected by MTT assay. As shown in Fig. 5A, HMBOX1 overexpression increased the sensitivity of HepG2 cells to NK cell cytolysis by 15–25%, while HMBOX1 knockdown aggravated the resistance of HepG2 cells to NK cell cytolysis (Fig. 5B). These findings indicated that low expression of HMBOX1 would help liver cancer cells escape NK cell-mediated immune surveillance.

HMBOX1 regulates the expression of genes associated with NK-cell cytolytic activity

The interaction between active/inactive NK cell receptors and cancer cell surface ligands is the first step of NK cell-mediated target cell killing. Therefore, we determined whether HMBOX1 could influence the expression of factors involved in NK cell-mediated cytotoxicity. As shown in Fig. 6A, Fas expression was increased in HepG2 cells transfected with pEGFP-N1-HMBOX1, and decreased upon HMBOX1 silencing by siRNA. In addition, the expression of PD-L1 was decreased in HepG2 cells transfected with pEGFP-N1-HMBOX1 (Fig. 6B and C). However, no differences were observed in the expression levels of ULBP2 and HLA-A/B/C, as well as anti-inflammatory factors IL-10 and TGF-β (data not shown). In addition, the inhibitory NKG2A receptor expressed on NK-92 cells was suppressed after co-incubation with HepG2 cells transfected with pEGFP-HMBOX1 (Fig. 6D) while no significant changes were observed with the activating receptor NKG2D (data not shown). These results indicated a protective role of HMBOX1 against liver cancer development via promotion of NK cell surveillance.

Discussion

HMBOX1 is a novel transcription repressor whose structure and function have not been fully characterized. In a previous study, we found that the expression of HMBOX1 was lower in liver carcinoma cells (8,15), although the biological significance was unclear. In the present study, we found a significant negative association between high HMBOX1 expression and differentiation degree of liver cancer (Fig. 1), indicating a role of HMBOX1 in liver cancer development.

Autophagy is a normal cellular process that degrades dysfunctional and unnecessary components. Studies have revealed a role of autophagy in various human liver diseases (3133). Earlier research demonstrated that autophagy exerts a suppressive function on tumors. During initial carcinogenesis, autophagy limited inflammation, p62 accumulation and oxidative stress response, thereby inhibiting genomic instability by maintaining cellular metabolic homeostasis (34). In addition, autophagy is known to inhibit inflammasome activation by removing endogenous sources of inflammasome agonists (35,36). Autophagy-deficient macrophages have insufficient microbial clearing capacity, resulting in increased bacillary burden and excessive pulmonary inflammation characterized by neutrophil infiltration, IL-17 response and increased IL-1α levels (37). In the present study, we found that HMBOX1 overexpression inhibited inflammation and promoted autophagy via the p38MAPK/AKT/mTOR signaling pathway in HepG2 cells (Fig. 3). This suggests that downregulated HMBOX1 would reduce autophagy, thereby destroying the protective role of the latter in inflammatory regulation and ultimately leading to the progression of liver cancer.

Many studies have suggested a hierarchical organization of heterogeneous cancer cells with a rare subset of cancer cells with stem cell features, known as cancer stem cells (CSCs), at the apex. CSCs are defined as a group of cells with high tumorigenicity, metastasis, and resistance to chemotherapy and radiation. Furthermore, CSCs have been implicated in tumor relapse after therapy (3840). CSCs have also been detected in liver cancer tissues, and the role of CD133 as a CSC marker in liver cancer has been confirmed in several studies. CD133-expressing cancer cells are responsible for tumor initiation or progression, and display stem-cell-like properties such as colony-forming ability and multi-potent differentiation potential (41,42). Notably, stem cell-related genes like CD133, KLF4, ESG1 and SOX2 were inhibited with increased HMBOX1 expression (Fig. 4). Concomitantly, liver metabolism-related genes like HPD and cytochrome p450 were upregulated by HMBOX1 overexpression. These results indicated that HMBOX1 suppressed the stemness of CSCs and maintained the normal metabolic function of hepatocytes, which is indispensable for physiological functions of the liver.

The liver is an important organ of the immune system as it harbors a large number of innate immune cells. Studies have increasingly revealed that NK cells play a critical role in tumor immuno-surveillance and act as the first line of the defense against carcinoma cells. The recognition between the NK cell receptors and cancer cell surface ligands is the first step in NK cell-mediated cell killing. Liver cancer can inhibit antitumor immune responses in the host through various mechanisms (43). We observed that HMBOX1 overexpression improved NK cell-mediated antitumor immune responses (Fig. 5).

HMBOX1 mediated PD-L1 expression could be the underlying molecular mechanism which attenuates the immunosuppressive effect induced by PD-1/PD-L1. In addition, HMBOX1 also increased Fas expression in cancer cells, and consequently Fas/FasL-mediated apoptosis. Lastly, co-incubation of HMBOX1-overexpressing HepG2 cells and NK-92 cells downregulated NKG2A expression of the latter, which indirectly triggered NK cell-mediated antitumor response (Fig. 6).

Collectively, to the best of our knowledge, we revealed for the first time that HMBOX1 expression level was negatively associated with the development of liver cancer. HMBOX1 possesses several protective roles, which include promoting cell autophagy, downregulating stemness-related genes, increasing HepG2 sensitivity to NK cell cytolysis and enhancing the function of NK cells, all of which suppress the development of liver cancer. These findings indicated that the targeted use of HMBOX1 agonists may enhance the therapeutic effects on liver cancer, and presents a new perspective on the mechanism of development and clinical therapy of liver cancer.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Natural Science Foundation of China (no. 81373222).

Availability of data and materials

All data generated or analyzed during this study are included in this published article and are available from the corresponding author upon reasonable request.

Authors' contributions

HZ performed the research on cell autophagy, stemness gene analysis and NK cell cytolytic activity, and was a major contributor in writing the manuscript. HJ and QH analyzed and interpreted the liver cancer specimen data and NK cell-mediated cytolysis. JZ performed the final verification of the manuscript and was involved in the conception of the study. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

The study was performed according to a protocol approved by the Ethics Committee of Qilu Hospital of Shandong University and was consistent with the standards established by the Declaration of Helsinki (as revised in Fortaleza, Brazil, October 2013). Written informed consents were obtained from all patients. Animal experiment protocols were approved by the Ethics Committee of Shandong University.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Schütte K, Bornschein J and Malfertheiner P: Hepatocellular carcinoma-epidemiological trends and risk factors. Dig Dis. 27:80–92. 2009. View Article : Google Scholar

2 

Lv B, Zhang L, Miao R, Xiang X, Dong S, Lin T, Li K and Kai Q: Comprehensive analysis and experimental verification of LINC01314 as a tumor suppressor in hepatoblastoma. Biomed Pharmacother. 98:783–792. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Marin JJG, Briz O, Herraez E, Lozano E, Asensio M, Di Giacomo S, Romero MR, Osorio-Padilla LM, Santos-Llamas AI, Serrano MA, et al: Molecular bases of the poor response of liver cancer to chemotherapy. Clin Res Hepatol Gastroenterol. 42:182–192. 2018. View Article : Google Scholar : PubMed/NCBI

5 

Cheng Z, Li X and Ding J: Characteristics of liver cancer stem cells and clinical correlations. Cancer Lett. 379:230–238. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Llovet JM and Bruix J: Systematic review of randomized trials for unresectable hepatocellular carcinoma: Chemoembolization improves survival. Hepatology. 37:429–442. 2003. View Article : Google Scholar : PubMed/NCBI

7 

Chen S, Saiyin H, Zeng X, Xi J, Liu X, Li X and Yu L: Isolation and functional analysis of human HMBOX1, a homeobox containing protein with transcriptional repressor activity. Cytogenet Genome Res. 114:131–136. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Dai J, Wu L, Zhang C, Zheng X, Tian Z and Zhang J: Recombinant expression of a novel human transcriptional repressor HMBOX1 and preparation of anti-HMBOX1 monoclonal antibody. Cell Mol Immunol. 6:261–268. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Holland PW, Booth HA and Bruford EA: Classification and nomenclature of all human homeobox genes. BMC Biol. 5:472007. View Article : Google Scholar : PubMed/NCBI

10 

Su L, Zhao H, Sun C, Zhao B, Zhao J, Zhang S, Su H and Miao J: The role of Hmbox1 in endothelial differentiation of bone-marrow stromal cells by a small molecule. ACS Chem Biol. 5:1035–1043. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Ma H, Su L, Yue H, Yin X, Zhao J, Zhang S, Kung H, Xu Z and Miao J: HMBOX1 interacts with MT2A to regulate autophagy and apoptosis in vascular endothelial cells. Sci Rep. 12:151212015. View Article : Google Scholar

12 

Feng X, Luo Z, Jiang S, Li F, Han X, Hu Y, Wang D, Zhao Y, Ma W, Liu D, et al: The telomere-associated homeobox-containing protein TAH1/HMBOX1 participates in telomere maintenance in ALT cells. J Cell Sci. 126:3982–3989. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Wu L, Zhang C, Zheng X, Tian Z and Zhang J: HMBOX1, homeobox transcription factor, negatively regulates interferon-γ production in natural killer cells. Int Immunopharmacol. 11:1895–1900. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Wu L, Zhang C and Zhang J: HMBOX1 negatively regulates NK cell functions by suppressing the NKG2D/DAP10 signaling pathway. Cell Mol Immunol. 8:433–440. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Dai J, Zhang C, Tian Z and Zhang J: Expression profile of HMBOX1, a novel transcription factor, in human cancers using highly specific monoclonal antibodies. Exp Ther Med. 2:487–490. 2011. View Article : Google Scholar : PubMed/NCBI

16 

López-Terrada D, Cheung SW, Finegold MJ and Knowles BB: Hep G2 is a hepatoblastoma-derived cell line. Hum Pathol. 40:1512–1515. 2009. View Article : Google Scholar

17 

Hou L, Li Y, Song H, Zhang Z, Sun Y, Zhang X and Wu K: Protective macroautophagy is involved in vitamin E succinate effects on human gastric carcinoma cell line SGC-7901 by inhibiting mTOR axis phosphorylation. PLoS One. 10:e01328292015. View Article : Google Scholar : PubMed/NCBI

18 

Zhang C, Jia X, Wang K, Bao J, Li P, Chen M, Wan JB, Su H, Mei Z and He C: Polyphyllin VII induces an autophagic cell death by activation of the JNK pathway and inhibition of PI3K/AKT/mTOR pathway in HepG2 cells. PLoS One. 11:e01474052016. View Article : Google Scholar : PubMed/NCBI

19 

Ghoshal S, Fuchs BC and Tanabe KK: STAT3 is a key transcriptional regulator of cancer stem cell marker CD133 in HCC. Hepatobiliary Surg Nutr. 5:201–203. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Bahnassy AA, Fawzy M, El-Wakil M, Zekri AR, Abdel-Sayed A and Sheta M: Aberrant expression of cancer stem cell markers (CD44, CD90, and CD133) contributes to disease progression and reduced survival in hepatoblastoma patients: 4-year survival data. Transl Res. 165:396–406. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Singh U, Quintanilla RH, Grecian S, Gee KR, Rao MS and Lakshmipathy U: Novel live alkaline phosphatase substrate for identification of pluripotent stem cells. Stem Cell Rev. 8:1021–1029. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Li Y, Li A, Glas M, Lal B, Ying M, Sang Y, Xia S, Trageser D, Guerrero-Cázares H, Eberhart CG, et al: c-Met signaling induces a reprogramming network and supports the glioblastoma stem-like phenotype. Proc Nat Acad Sci USA. 108:9951–9956. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Noguchi K, Eguchi H, Konno M, Kawamoto K, Nishida N, Koseki J, Wada H, Marubashi S, Nagano H, Doki Y, et al: Susceptibility of pancreatic cancer stem cells to reprogramming. Cancer Sci. 106:1182–1187. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Kawasaki A, Shinkai Y, Yagita H and Okumura K: Expression of perforin in murine natural killer cells and cytotoxic T lymphocytes in vivo. Eur J Immunol. 22:1215–1219. 1992. View Article : Google Scholar : PubMed/NCBI

25 

Subleski JJ, Hall VL, Back TC, Ortaldo JR and Wiltrout RH: Enhanced antitumor response by divergent modulation of natural killer and natural killer T cells in the liver. Cancer Res. 66:11005–11012. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Bai X, Wang S, Tomiyama-Miyaji C, Shen J, Taniguchi T, Izumi N, Li C, Bakir HY, Nagura T, Takahashi S, et al: Transient appearance of hepatic natural killer cells with high cytotoxicity and unique phenotype in very young mice. Scand J Immunol. 63:275–281. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Yang Y, Han Q, Hou Z, Zhang C, Tian Z and Zhang J: Exosomes mediate hepatitis B virus (HBV) transmission and NK-cell dysfunction. Cell Mol Immunol. 14:465–475. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Xu D, Han Q, Hou Z, Zhang C and Zhang J: miR-146a negatively regulates NK cell functions via STAT1 signaling. Cell Mol Immunol. 14:712–720. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Ishiyama K, Ohdan H, Ohira M, Mitsuta H, Arihiro K and Asahara T: Difference in cytotoxicity against hepatocellular carcinoma between liver periphery natural killer cells in humans. Hepatology. 43:362–372. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Sung MW, Johnson JT, Van Dongen G and Whiteside TL: Protective effects of interferon-gamma on squamous-cell carcinoma of head and neck targets in antibody-dependent cellular cytotoxicity mediated by human natural killer cells. Int J Cancer. 66:393–399. 1996. View Article : Google Scholar : PubMed/NCBI

31 

Rautou PE, Mansouri A, Lebrec D, Durand F, Valla D and Moreau R: Autophagy in liver diseases. J Hepatol. 53:1123–1134. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Czaja MJ: Functions of autophagy in hepatic and pancreatic physiology and disease. Gastroenterology. 140:1895–1908. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Kwanten WJ, Martinet W, Michielsen PP and Francque SM: Role of autophagy in the pathophysiology of nonalcoholic fatty liver disease: A controversial issue. World J Gastroenterol. 20:7325–7338. 2014. View Article : Google Scholar : PubMed/NCBI

34 

Sun K, Guo XL, Zhao QD, Jing YY, Kou XR, Xie XQ, Zhou Y, Cai N, Gao L, Zhao X, et al: Paradoxical role of autophagy in the dysplastic and tumor-forming stages of hepatocarcinoma development in rats. Cell Death Dis. 4:e5012013. View Article : Google Scholar : PubMed/NCBI

35 

Zhou R, Yazdi AS, Menu P and Tschopp J: A role for mitochondria in NLRP3 inflammasome activation. Nature. 469:221–225. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Nakahira K, Haspel JA, Rathinam VA, Lee SJ, Dolinay T, Lam HC, Englert JA, Rabinovitch M, Cernadas M, Kim HP, et al: Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nat Immunol. 12:222–230. 2011. View Article : Google Scholar : PubMed/NCBI

37 

Castillo EF, Dekonenko A, Arko-Mensah J, Mandell MA, Dupont N, Jiang S, Delgado-Vargas M, Timmins GS, Bhattacharya D, Yang H, et al: Autophagy protects against active tuberculosis by suppressing bacterial burden and inflammation. Proc Nat Acad Sci USA. 109:E3168–E3176. 2012. View Article : Google Scholar : PubMed/NCBI

38 

Jordan CT, Guzman ML and Noble M: Cancer stem cells. N Engl J Med. 355:1253–1261. 2006. View Article : Google Scholar : PubMed/NCBI

39 

Magee JA, Piskounova E and Morrison SJ: Cancer stem cells: Impact, heterogeneity, and uncertainty. Cancer Cell. 21:283–296. 2012. View Article : Google Scholar : PubMed/NCBI

40 

Ma S: Biology and clinical implications of CD133+ liver cancer stem cells. Exp Cell Res. 319:126–132. 2013. View Article : Google Scholar : PubMed/NCBI

41 

Ma S, Chan KW, Hu L, Lee TK, Wo JY, Ng IO, Zheng BJ and Guan XY: Identification and characterization of tumorigenic liver cancer stem/progenitor cells. Gastroenterology. 132:2542–2556. 2007. View Article : Google Scholar : PubMed/NCBI

42 

Rountree CB, Senadheera S, Mato JM, Crooks GM and Lu SC: Expansion of liver cancer stem cells during aging in methionine adenosyltransferase 1A-deficientmice. Hepatology. 47:1288–1297. 2008. View Article : Google Scholar : PubMed/NCBI

43 

Sui Q, Zhang J, Sun X, Zhang C, Han Q and Tian Z: NK cells are the crucial antitumor mediators when STAT3-mediated immunosuppression is blocked in hepatocellular carcinoma. J Immunol. 193:2016–2023. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

September 2018
Volume 40 Issue 3

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Zhao, H., Jia, H., Han, Q., & Zhang, J. (2018). Homeobox containing 1 inhibits liver cancer progression by promoting autophagy as well as inhibiting stemness and immune escape. Oncology Reports, 40, 1657-1665. https://doi.org/10.3892/or.2018.6551
MLA
Zhao, H., Jia, H., Han, Q., Zhang, J."Homeobox containing 1 inhibits liver cancer progression by promoting autophagy as well as inhibiting stemness and immune escape". Oncology Reports 40.3 (2018): 1657-1665.
Chicago
Zhao, H., Jia, H., Han, Q., Zhang, J."Homeobox containing 1 inhibits liver cancer progression by promoting autophagy as well as inhibiting stemness and immune escape". Oncology Reports 40, no. 3 (2018): 1657-1665. https://doi.org/10.3892/or.2018.6551