This article is mentioned in:

Introduction

C-X-C motif chemokine (CXCL)12 and its receptors, C-X-C chemokine receptor type (CXCR)4 and CXCR7/atypical chemokine receptor 3, are central to the control of cell migration and cell positioning during development (1), as well as under various pathophysiological conditions, such as cancer (2). In a large number of human malignancies, including prostate, breast, lung, pancreas and colon/rectum cancer, the CXCL12 pathway not only controls tumor growth and angiogenesis, but also acts as a key regulator of tumor metastasis (3,4). In tumors, several sources of CXCL12 have been identified, including tumor cells themselves, cancer-associated fibroblasts (CAFs) and endothelial cells, among others (3,5). In addition, most tumor cells also express detectable levels of both CXCR4 and CXCR7 (6). However, the tumorigenic effects of CXCL12 are mediated by either CXCR4 and/or CXCR7 depending on the cell type, the reasons of which are currently unknown (6). Thus, the signaling mechanisms underlying the tumorigenic effects of CXCL12 remain unclear.

The two CXCL12 receptors show similarities, as well as distinct differences in their signaling behavior. CXCR4 is a classical G protein-coupled chemokine receptor that preferentially activates cell signaling through Gi, but also through Gq and G12/G13 (7). However, in certain cell types, such as HeLa cells, 293 cells and podocytes, CXCR4-dependent cell signaling and subsequent effects on cell migration and adhesion appear to be mediated by β-arrestin1 and/or β-arrestin2 (8–10).

Depending on the context and cell type, CXCR7 has different functions. For example, CXCR7 can act as a scavenging receptor, allowing CXCR4-dependent cell migration by shaping the extracellular CXCL12 gradient (11). CXCR7 also acts as an active signaling receptor, affecting the same cell functions as CXCR4, including cell proliferation, migration and invasion (12). To date, several studies have provided evidence that CXCR7 activates cell signaling through β-arrestin2 (13–15), while known exceptions are primary astrocytes and certain glioma cells. In these cells, ligand-activated CXCR7 binds and activates G proteins and thus appears to function as a classical chemokine receptor (16,17).

Another known mechanism by which CXCL12 receptors activate cell signaling is through transactivation of EGFR family members via Src. This mechanism is currently best documented for CXCR4 (18–24) in cancer cells, but has also been suggested for CXCR7 in embryonic cells (25).

The fact that CXCR4 and CXCR7 can form homomers or heteromers adds further complexity to CXCL12 signaling (12). CXCR4/CXCR7 heteromers allow for enhanced recruitment of β-arrestin to the receptor complex compared with receptor monomers/homodimers (26), ultimately altering the kinetics of activated signaling pathways (27). In addition, CXCR4 homomers have been shown to be more efficient than CXCR4 monomers in promoting the migration of a variety of cell lines, such as 293 and HeLa cells (28). Finally, CXCR4 dimers appear to form nanoclusters involving specific transmembrane residues. Nanoclusters are considered essential for full activation of CXCR4, and thus for maximal cellular responses (29).

The outlined concept of CXCR4 and CXCR7 signaling is additionally complicated by several novel roles of β-arrestins in G protein-coupled receptor (GPCR) signaling. Initially, β-arrestins were believed to facilitate endocytosis of GPCRs. More recently, β-arrestin1 was found to additionally mediate the interaction between the plasma membrane and internal pools of CXCR4 (30), thereby defining the final cellular response by coordinating receptor signaling at the cell surface and at internal sites (30). In addition, evidence has emerged that GPCRs also activate cell signaling through Gαi/β-arrestin complexes (31).

To better understand CXCL12 signaling in tumorigenesis, the present study investigated whether CXCL12/CXCR4- and CXCL12/CXCR7-dependent control of cancer cell migration, and thus metastatic behavior, depends on G proteins, arrestins or both. It was also examined whether CXCL12-induced cell migration involves transactivation of EGFR. To this end, several human tumor cell lines were used, which have recently been characterized in terms of the receptors activated by CXCL12 to control cell migration in our previous study (6). Tumor cells were analyzed for CXCL12-dependent cell migration following pharmacological inhibition of either Gα proteins, EGFR or Src kinase, as well as following depletion of arrestins by RNA interference.

Materials and methods

Cell culture

The human tumor cell lines A549 (lung adenocarcinoma), C33A (cervical carcinoma), DLD-1 (colorectal adenocarcinoma), MDA-MB-231 (breast adenocarcinoma) and PC-3 (prostate carcinoma) were purchased from American Type Culture Collection. These cell lines were selected because the respective tumors are known to be affected by the CXCL12 pathway (3). The cell line authenticity was verified by the supplier using short tandem repeat profiling. Cell lines were regularly tested for mycoplasma contamination using MycoSpy® Master Mix (Biontex Laboratories GmbH). Cells were plated on 12-well culture plates (TPP Techno Plastic Products AG), and grown in either DMEM (4.5 g/l glucose) for C33A, MDA-MB-231 and PC-3 or RPMI-1640 for A549 and DLD-1, supplemented with 0.05% gentamycin and 10% fetal bovine serum (FBS) (all from Gibco; Thermo Fisher Scientific, Inc.) at 37°C in a water-saturated atmosphere of 95% air and 5% CO2. For experiments, cell cultures at 60% confluence were starved for 24 h in their corresponding serum-free culture medium at 37°C, supplemented with or without pertussis toxin (PTX; 100 ng/ml pre-dissolved; cat. no P2980; Sigma-Aldrich; Merck KGaA), followed by addition of the following compounds for 1 h: CCX771 (CXCR7 antagonist; 100 nM dissolved in DMSO; Amgen, Inc.), AMD3100 (CXCR4 antagonist; 10 µM dissolved in double-distilled water; Sigma-Aldrich; Merck KGaA), Tyrphostin AG1478 (EGFR inhibitor; 2 µM dissolved in DMSO; cat. no. T4182; Sigma-Aldrich; Merck KGaA), Src inhibitor-1 (Src-I1; Src kinase inhibitor; 10 µM dissolved in DMSO; Sigma-Aldrich; Merck KGaA). For control purposes, untreated cells were supplemented with appropriate concentrations of DMSO.

Western blot analysis

For western blot analysis, cultured A549, C33A, DLD-1, MDA-MB-231 and PC3 cells were harvested and immediately placed in liquid nitrogen. Total protein was isolated in RIPA protein extraction buffer (cat. no. 89901; Thermo Fisher Scientific, Inc.) supplemented with protease and phosphatase inhibitors (cat. no. 78442; Thermo Fisher Scientific, Inc.) to prevent protein dephosphorylation. Protein content was determined using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Proteins (10–20 µg/lane) were separated using 10% SDS-PAGE and transferred to nitrocellulose membranes by electroblotting. After blocking non-specific binding sites with Pierce Fast Blocking Buffer (cat. no. 37575; Thermo Fisher Scientific, Inc.) for 60 min at room temperature, the membranes were incubated overnight at 4°C with one of the following primary antibodies: Rabbit anti-EGFR (1:1,000; cat. no. 4267; Cell Signaling Technology Europe, B.V.), rabbit anti-β-arrestin2 (1:1,000; cat. no. 3857; Cell Signaling Technology Europe, B.V.) and mouse monoclonal anti-β-arrestin1 (1:1,000; cat. no. MA1-183; Thermo Fisher Scientific, Inc.). Subsequently, the membranes were incubated at room temperature for 1 h with HRP-conjugated anti-mouse (1:10,000; cat. no. PI-2000-1; Vector Laboratories, Inc.) or anti-rabbit (1:10,000; cat. no. 711-035-152; Jackson ImmunoResearch Laboratories Europe, Ltd.) secondary antibodies. Antibody-labeling was visualized using Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific, Inc.). To control for protein loading, membranes were re-probed with rabbit anti-β-actin (1:5,000; cat. no. 4970; Cell Signaling Technology Europe, B.V.) or mouse anti-GAPDH (1:5,000; cat. no. 10R-G109A; Fitzgerald Industries International) antibodies. Chemiluminescence was captured on a Biostep Celvin S imager (Biostep; Bionis) and immunoreactive protein bands were quantified using the Snap and Go 1.8.3 software (Biostep; Bionis).

Chemotaxis assay

Chemotactic responses of A549, C33A, DLD-1, MDA-MB-231 and PC3 cells to CXCL12 were determined in a modified 12-well or 48-well Boyden chamber (Neuro Probe Inc.), in which the upper and lower wells were separated by polyornithine-coated Nucleopore® PVP-free polycarbonate filter (Whatman plc; Cytiva; 8-µm pore size). For seeding, pretreated cells were counted using an improved Neubauer chamber and ~10,000 cells were placed in serum-free DMEM or RPMI medium into the upper well of the Boyden chamber. A total of 150 µl of the respective serum-free medium supplemented with CXCL12 (100 ng/ml; PeproTech, Inc.) were added to the lower chamber. The chamber was incubated at 37°C in a water-saturated atmosphere of 95% air and 5% CO2 for 4 h. After incubation, non-migrated cells attached to the upper part of the membrane were wiped off, and migrated cells attached to the lower part of the membrane were fixed with ice-cold methanol (100%) at room temperature for 5 min, stained with DAPI (1:5,000; AAT Bioquest, Inc.; 5 min, room temperature), and counted on an Olympus BX40 microscope using the Olympus cellSens Dimension software (Olympus Corporation) at a final magnification of 50×. The number of cells migrating in the absence of CXCL12 was set to 1 and the migration index was calculated as the ratio of cells migrating in the presence and absence of CXCL12.

RNA interference

Predesigned human β-arrestin1 small interfering (si)RNA (cat. no. 4392420; Assay ID, s1624) and human β-arrestin2 (cat. no. 4392420; Assay ID, s1625), as well as control siRNA (cat. no. 4390844) were purchased from Thermo Fisher Scientific, Inc. The sequences of the siRNAs are presented in Table I. Transfection of A549, C33A, DLD-1, MDA-MB-231 and PC3 cells with siRNA (75 pmol/well) was performed in 6-well plates (TPP Techno Plastic Products AG) at 37°C in the presence of serum-free DMEM or RPMI-medium using the siPORT Amine Transfection Agent (cat. no. AM4503; Thermo Fisher Scientific, Inc.) for 16 h. Transfected cells were further maintained with serum-free DMEM or RPMI-medium and subjected to experiments after 24 h. The success of RNA interference was validated by western blotting and reverse transcription-quantitative (RT-q)PCR. Cells treated with PTX (100 ng/ml, 24 h) were used as a positive control for inhibited cell migration.

Table I. Sequences of small interfering RNAs used.

Table I.

Sequences of small interfering RNAs used.

Gene	Sense (5′-3′)	Antisense (5′-3′)
Human β-arrestin1	CCAAUCUCAUAGAACUUGATT	UCAAGUUCUAUGAGAUUGGTA
Human β-arrestin2	AAGUCUCUGUGAGACAGUATT	UACUGUCUCACAGAGACUUTG
Control	Sequence confidential, not provided by the supplier

RT-qPCR

Briefly, total RNA was extracted from A549, C33A, DLD-1, MDA-MB-231 and PC3 cells using InviTrap Spin Universal RNA Mini Kit (Invitek Diagnostics), followed by reverse transcription of 1 µg RNA using Protoscript First Strand cDNA Synthesis Kit (New England BioLabs, Inc.) as per the manufacturer's instructions. For quantification of gene expression, qPCR analysis was performed with PowerUp SYBR Green Master Mix (cat. no. A25742; Thermo Fisher Scientific, Inc.) on a CFX96 thermal cycler system (Bio-Rad Laboratories, Inc.). PCR conditions consisted of an initial denaturation step at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 59.5°C for 30 sec and 72°C for 30 sec. Gene expression was calculated using the 2−ΔΔCq method (32) and normalized to β-actin. Primer sequences are listed in Table II.

Table II. Sequences of primers used.

Table II.

Sequences of primers used.

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)
Human β-arrestin1	GACCATGGGCGACAAAGG	GGTAGACGGTGAGCTTTCCATT
Human β-arrestin2	GGAAGCTGGGCCAGCAT	TGTGACGGAGCATGGAAGATT
Human CXCL12	CACAGAAGGTCCTGGTGGTA	CATTGAAAAGCTGCAATCAC
Human β-actin	GGCCTCGCTGTCCACCTT	TGTCACCTTCACCGTTCCAGTTTT

[i] CXCL12, C-X-C motif chemokine 12.

Statistical analysis

Data are presented as the mean ± SD Experiments were replicated at least three times. When results showed large variations, a total of up to 15 replicates were used. GraphPad Prism 9 (Dotmatics) was used for statistical analysis. One-way ANOVA followed by Tukey's post hoc test was employed for multiple comparisons. P<0.05 was considered to indicate a statistically significant difference.

Results

CXCL12 induces cancer cell migration via the differential activation of CXCR4 and/or CXCR7

Consistent with our previous study (6), CXCL12 at 100 ng/ml induced chemotaxis of all tumor cell lines as evidenced by a 2- to 3-fold increase in their migration index (Fig. 1). In addition, the CXCR4 antagonist AMD3100 and the CXCR7 antagonist CCX771 attenuated the CXCL12-induced migration of C33A, MDA-MB-231 and PC-3 cells (Fig. 1), suggesting that the chemotactic responses of these cells to CXCL12 are mediated by both CXCR4 and CXCR7. Furthermore, the CXCL12-induced migration of DLD-1 cells was sensitive to CCX771, but not to AMD3100, confirming the previously suggested primary role of CXCR7 in the CXCL12-dependent migration of DLD-1 cells (6). In further accordance with our previous study, CXCL12-induced migration of A549 cells was sensitive to CCX771. However, in contrast to the previous observation showing a tendency of AMD3100 to attenuate CXCL12-induced migration of A549 cells (6), a statistically significant decrease in the numbers of migrating A549 cells treated with AMD3100 and CXCL12 compared with CXCL12 alone was observed in the present study (Fig. 1). This discrepancy likely reflects the use of a 12-well Boyden chamber for chemotactic analysis in the present experiments compared with a 48-well Boyden chamber plated with 5,000 cells per well in our previous study (6). Comparison of the chemotactic responses of A549 cells to CXCL12 in the presence and absence of receptor antagonists under the different experimental set-ups indicated more pronounced inhibitory responses in the 12-well Boyden chamber compared with the 48-well Boyden chamber assay, the reason of which is currently unknown (Fig. S1). The mechanism responsible for this discrepancy is currently unknown, but may well reflect differences in cell adhesion in the different sized chambers. These data imply that contrary to the conclusion of our previous study, CXCL12-dependent chemotaxis of A549 cells is mediated by both CXCR7 and CXCR4 and not solely CXCR7.

Figure 1. Effects of CXCL12 receptor antagonists and PTX on the CXCL12-dependent chemotaxis of cancer cells. Cancer cells were treated with either AMD3100 (10 µM, 1 h), CCX771 (100 nM, 1 h), PTX (100 ng/ml, 24 h) or none and subsequently assayed for their migration index to CXCL12 (100 ng/ml) in a modified 12-well Boyden chamber for 4 h. The number of cells migrating in the absence of CXCL12 was set to 1 and the migration index was calculated as the ratio of cells migrating in the presence and absence of CXCL12 a. Data are presented as the mean ± SD (n=3-15). aP<0.001 vs. control; bP<0.001 vs. none. CXCL12, C-X-C motif chemokine 12; PTX, pertussis toxin.

Tumor cells have been reported to express CXCL12 (5). The present RT-qPCR analysis revealed low levels of expression of CXCL12 mRNA in C33A cells which became detectable only after 30 PCR cycles. By contrast, in A549, DLD-1, MDA-MB-231 and PC3 cells, CXCL12 mRNA was virtually undetectable after 30 PCR cycles (data not shown). These findings suggest that CXCL12 in respective tumors is predominantly derived from non-tumor cells, such as CAFs or endothelial cells (5). These findings further argue against the possibility that the current analyses are biased by endogenous CXCL12.

Evaluation of the role of G proteins and arrestins in CXCR4 and CXCR7 signaling

It is has been demonstrated that CXCR4 and CXCR7 initiate cell signaling through either G proteins (preferentially Gα protein) or β-arrestin1/β-arrestin2, depending on the cell type and context (7–10,12). To assess the role of Gα proteins in CXCL12-dependent tumor cell migration, the migratory responses of tumor cells previously treated with PTX (100 ng/ml) for 24 h were analyzed. PTX partially or completely prevented the CXCL12-induced chemotaxis of A549, C33A, DLD-1, MDA-MB-231 and PC-3 cells (Figs. 1 and S2). To determine whether arrestins are additionally involved in CXCL12-induced tumor cell migration, cells were transfected with siRNA recognizing β-arrestin1 mRNA, β-arrestin2 mRNA or both. Western blot and RT-qPCR analyses confirmed a substantial 60–98% decrease in both β-arrestin1 and β-arrestin2 protein as well as mRNA levels on day 2 post transfection (Figs. S3 and S4). The depletion of β-arrestins had no apparent effect on the chemotactic responses of tumor cells to CXCL12, which were similar to those observed with wild-type cells (Figs. 2 and S5). Furthermore, in A549, C33A, MDA-MB-231 and PC-3 cells neither PTX treatment nor β-arrestin depletion affected the sensitivity of CXCL12-induced chemotaxis to AMD3100 and/or CCX771 (Figs. 1 and 2). Similarly, the sensitivity of CXCL12-induced chemotaxis to these inhibitors was unaffected after transfection of cells with control siRNA (Figs. S6 and S7). Collectively, these findings suggested that inhibition of CXCR4 or CXCR7 is not associated with a switch from the inactive to the active state of the receptor downstream CXCL12 signaling. However, it was also observed that transfection of DLD-1 cells with control siRNA or β-arrestin siRNA rendered CXCL12-dependent chemotaxis partially sensitive to AMD3100, the reason of which is unclear (Figs. 2 and S6). Collectively, these findings indicated that CXCL12-induced tumor cell migration mediated by CXCR4 and/or CXCR7 is typically dependent on Gαi/o signaling.

Figure 2. CXCL12-induced chemotaxis of cancer cells is independent of arrestins. Cancer cells were transfected with siRNA against both β-arrestin1 and β-arrestin2 and migration index for CXCL12 (100 ng/ml) was determined after 2 days. In certain experiments, cells were additionally treated with either AMD3100 (10 µM), CCX771 (100 nM), or none for 1 h prior to analysis. Data are presented as the mean migration index ± SD (n=5-12). aP<0.001 vs. control; bP<0.001 vs. none. CXCL12, C-X-C motif chemokine 12; PTX, pertussis toxin; siRNA, small interfering RNA.

CXCR4 and CXCR7 control cancer cell migration via the transactivation of EGFR

Among others, G proteins activate cell signaling through Src-dependent transactivation of EGFR family members, including EGFR/ErbB1 (18). Western blotting demonstrated that the tumor cell lines used in the present study expressed EGFR at varying levels, with the lowest levels observed in C33A cells (Fig. S8). To assess the putative role of EGFR transactivation in the chemotactic responses of A549, C33A, DLD-1, MDA-MB-231 and PC-3 cells to CXCL12, chemotaxis was re-analyzed after pretreatment of the cells with the EGFR inhibitor AG1478 (2 µM) for 1 h. AG1478 completely abolished the CXCL12-dependent chemotactic responses of the different cell lines (Figs. 3 and S9). These inhibitory effects were not affected by the additional treatment of the cells with PTX (Fig. 3). Transactivation of EGFR typically occurs via Src according to previous reports (18–23). The chemotactic responses of the different cell lines to CXCL12 were also prevented after pretreatment with the Src kinase inhibitor Src-I1 (10 µM) for 1 h (Figs. 4 and S10). Again, these inhibitory effects were not further modulated by PTX treatment (Fig. 4). To evaluate the putative effects of the different inhibitors on EGFR expression, tumor cells were treated with either PTX (100 ng/ml) for 24 h or AG1478 (2 µM) and Src-I1 (10 µM) for 1 h, and EGFR expression levels were then analyzed by western blotting. None of the treatments resulted in obvious changes in EGFR protein, implying that the observed inhibitory effects are not due to the loss or reduction of EGFR expression (Fig. S8).

Figure 3. CXCL12 induces cancer cell migration via EGFR transactivation. Cancer cell lines were treated with either the EGFR inhibitor AG1478 (2 µM) for 1 h or none and migration index was determined for CXCL12 (100 ng/ml). Cells pretreated with PTX (100 ng/ml, 24 h) were used as a positive control for inhibited cell migration. Data are presented as the mean migration index ± SD (n=16-20). aP<0.001 vs. control; bP<0.001 vs. none. CXCL12, C-X-C motif chemokine 12; PTX, pertussis toxin.

Figure 4. CXCL12 transactivates EGFR via Src. Cancer cell lines were treated with the Src inhibitor Src-I1 (10 µM) for 1 h or none and migration index was determined for CXCL12 (100 ng/ml). Cells pretreated with PTX (100 ng/ml, 24 h) served as a positive control for inhibited cell migration. Data are presented as the mean migration index ± SD (n=16-20). aP<0.001 vs. control; bP<0.001 vs. none. CXCL12, C-X-C motif chemokine 12; PTX, pertussis toxin; Src-I1, Src inhibitor-1.

Taken together, these findings identified Src-dependent transactivation of EGFR as a common mechanism underlying CXCL12-induced migration of tumor cells from a number of organs. In addition, the present results showed that both CXCR4 and CXCR7 signal through EGFR transactivation in tumor cells.

Discussion

In recent years, CXCL12 and its receptors, CXCR4 and CXCR7, have emerged as critical regulators of tumor metastasis, and have therefore attracted considerable attention as potential therapeutic targets in numerous human malignancies, including prostate, breast, lung and pancreatic cancer, gliomas and multiple myeloma (3,4,33). An ongoing controversy is whether CXCR4 and CXCR7 control cell migration and thus metastasis by activating cell signaling via G proteins and/or arrestins (12). This issue is further complicated by the fact that CXCL12 mediates its chemotactic effects through either CXCR4 and/or CXCR7, depending on the cell type (6). Notably, the selective use of CXCR4 and/or CXCR7 receptors by tumor cells is not reflected by their cellular expression levels, and the mechanism of selective receptor activation remains to be further elucidated (6). The present analyses of five different human tumor cell lines in which CXCL12-induced chemotaxis is mediated either by CXCR4 and CXCR7 (A549, C33A, MDA-MB-231 and PC-3) or only by CXCR7 (DLD-1) unraveled the dependence of CXCL12-induced cancer cell migration on G proteins. In addition, the present study provided evidence that ligand-dependent activation of CXCR4 and/or CXCR7 induced cell signaling via Src-mediated transactivation of EGFR, as judged from the absence of CXCL12-dependent chemotaxis following pharmacological inhibition of EGFR or Src kinase and the established role of Src in EGFR (trans)activation (18–23). These additional insights into the molecular mechanisms of CXCL12-mediated cancer cell migration may have implications for current efforts to establish CXCR4 or CXCR7 as therapeutic targets in cancer (34).

Ligand-bound CXCR4 has been reported to activate both G protein- and arrestin-dependent cell signaling, whereas ligand-bound CXCR7 is believed to activate arrestin-dependent signaling (12). Currently known exceptions are primary cortical rat astrocytes and certain glioma cells, in which CXCR7 activates G proteins (16,17). In the present study, CXCL12-induced migration of the various tumor cells required activation of Gαi/o, but not arrrestins, as evidenced by the attenuated cell migration in the presence of PTX and sustained cell migration following siRNA-mediated cellular depletion of β-arrestin1 and β-arrestin2. In addition, the Gαi/o-dependent mechanism was observed in tumor cells, in which CXCL12 cell migration was induced through both CXCR4 and CXCR7 (A549, C33A, MDA-MB-231 and PC-3) as well as CXCR7 alone (DLD-1). These findings expand the range of cells in which CXCR7 activates or at least assists in the activation of G proteins. It should be emphasized that the observed lack of effects of arrestin depletion on cell migration cannot be attributed to residual low levels of β-arrestin in β-arrestin siRNA-transfected cells. Our previous study has demonstrated that reducing β-arrestin2 levels in primary astrocytes to 20% by siRNA is sufficient to abolish CXCL11-signaling (17). The observed persistence of the migratory responses of β-arrestin-depleted tumor cells to CXCL12 further excludes the involvement of previously proposed alternative mechanisms by which β-arrestin may control cell function, such as i) β-arrestin-mediated communication between the cell surface-associated pool and the intracellular pool of CXCL12 receptors (30); and ii) the induction of cell signaling by Gαi/β-arrestin complexes. (31). It could be hypothesized that CXCR4 and CXCR7 cooperate in A549, C33A, MDA-MB-231 and PC-3 cells through the formation of receptor heteromers (35). However, the observed dependence of CXCL12-induced chemotaxis on G proteins argues against this mechanism. Previous studies have shown that the formation of CXCR4/CXCR7 heteromers attenuates G protein-dependent cell signaling and promotes arrestin signaling (26,36). As these results were obtained in cells with ectopic overexpression of CXCR4 and CXCR7, the possibility that intrinsic CXCR4 and CXCR7 function differentially cannot be excluded (12).

Activated G proteins induce cell signaling through Src-mediated transactivation of EGFR family members, among other mechanisms. This mechanism is currently best studied for ligand-activated CXCR4, which transactivates EGFR via Gαi and subsequently promotes tumor cell migration and invasion (18,19,21,22,24) and proliferation (20,23). To date, only one study has shown that EGFR transactivation also occurs through ligand-activated CXCR7 (25). The present findings identified Src-dependent transactivation of EGFR as the common molecular mechanism via which CXCL12 controls tumor cell migration and potentially metastasis. Importantly, EGFR transactivation occurred in tumor cells in which either CXCR7 alone or together with CXCR4 mediated CXCL12-dependent chemotaxis. In addition, both the EGFR inhibitor AG1478 and the Src kinase inhibitor Src-I1 attenuated the CXCL12-induced chemotactic responses in all tumor cells. Notably, our previous study has demonstrated that CXCL12 controls the migration of various tumor cells through ERK- and/or PI3K/Akt-mediated signaling (37), the major signaling pathways activated by EGFR (38). Although EGFR transactivation emerged as a common molecular downstream event in CXCL12-induced migration of the tumor cells examined in the present study, not all malignant and non-malignant cells may utilize this mechanism. For example, CXCR4-dependent migration and homing of endothelial colony-forming cells requires G protein-induced calcium activation (39). By contrast, CXCR7-dependent migration of cholangiocarcinoma cells and melanocytes requires arrestin signaling (13,15). However, these studies did not exclude the involvement of EGFR, which is also transactivated by arrestins (40–42). The interplay between CXCL12 receptors and ErbB family members is not limited to receptor transactivation, but is more complex. For example, EGFR and other ErbB family members (such as ErbB3) control the expression of CXCL12 receptors and vice versa (43–52). In addition, CXCR7 can directly interfere with the ligand-activated signaling of EGFR, probably by its direct coupling to EGFR (53–55). The extent to which this interplay also occurs in tumors and further modulates CXCL12-induced tumor cell migration remains to be elucidated. CXCL12 and its receptors appear to affect different cell functions through different receptors/molecular mechanisms (12). For example, CXCL12 induces chemotaxis of MDA-MB-341 cells via CXCR4 and CXCR7, but promotes their proliferation only through CXCR4 (6). Hence, future studies are needed to define whether the effects of CXCL12 on other tumor cell functions, such as cell survival and proliferation, are also dependent on EGFR transactivation.

Taken together, the present study revealed that the CXCL12-CXCR4-CXCR7 chemokine system controls tumor cell migration and potentially tumor metastasis through a common signaling pathway involving Gα/Scr-dependent transactivation of EGFR. This points to EGFR inactivation as a favorable therapeutic approach to prevent the CXCL12-induced expansion of various tumor types. The success of this approach is independent of whether CXCL12 affects cancer cell migration through CXCR4 or CXCR7. Several inhibitors of wild-type EGFR are currently used in the clinic (56). However, their application to the CXCL12-dependent tumor cell expansion requires further verification in vivo.

Supplementary Material

Supporting Data

Acknowledgements

We would like to thank Dr James Campbell (Amgen, Inc.) for donating the CCX771 compound and Mr. Florian Kirmse (Institute of Anatomy, University of Leipzig) for technical assistance.

Funding

Funding: No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

KZN and JE contributed to the study conception and design and interpretation of the data. FK acquired and analyzed the data. JE drafted the manuscript. KZN and FK revised the manuscript. KZN and FK confirm the authenticity of the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References