Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
November-2017 Volume 16 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2017 Volume 16 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Tumor necrosis factor‑α and interleukin‑6 suppress microRNA‑1275 transcription in human adipocytes through nuclear factor‑κB

  • Authors:
    • Yu‑Feng Zhou
    • Zi‑Yi Fu
    • Xiao‑Hui Chen
    • Yan Cui
    • Chen‑Bo Ji
    • Xi‑Rong Guo
  • View Affiliations / Copyright

    Affiliations: School of Nursing, Nanjing Medical University, Nanjing, Jiangsu 210004, P.R. China, Department of Children Health Care, Nanjing Maternal and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing, Jiangsu 210004, P.R. China
    Copyright: © Zhou et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 5965-5971
    |
    Published online on: August 29, 2017
       https://doi.org/10.3892/mmr.2017.7392
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Obesity is a confirmed risk factor for hyperlipidemia, type‑II diabetes, hypertension, and cardiovascular disease. MicroRNAs (miRs) have emerged as an important field of study within energy metabolism and obesity. A previous study demonstrated miR‑1275 to be markedly down‑regulated during maturation of human preadipocytes. It has been reported that miR‑1275 dysregulates expression in several types of cancer and infections. Little is currently known about the regulation of miR‑1275 transcription. The aim of the current study was to explore the mechanism underlying the expression of miR‑1275 in mature human adipocytes. After differentiation, human adipocytes were incubated with tumor necrosis factor (TNF)‑α and interleukin‑6. The results of reverse transcription‑quantitative polymerase chain reaction demonstrated that miR‑1275 can be down‑regulated by TNF‑α and IL‑6, in human mature adipocytes. Bioinformatic analysis was used to predict nuclear factor (NF)‑κB binding sites of miR‑1275's promoter region. Luciferase assay and rescue experiments were performed in HEK293T cells. NF‑κB was involved in regulating miR‑1275 transcription by binding to its promoter. In response to TNF‑α, NF‑κB was bound to the promoter of miR‑1275 and inhibited its transcription. These results indicated that inflammatory factors could regulate miR‑1275 transcription through NF‑κB and influencing miR‑1275 effects on obesity.

Introduction

As of 2014, 39% of adults worldwide were overweight and 13% were obese (1). Obesity is a confirmed risk factor for hyperlipidemia, type-II diabetes, hypertension and cardiovascular disease (2). Globally, 44% cases of diabetes, 23% cases of ischemic heart disease and 7–41% cases of certain types of cancer are attributable to excess weight and obesity (1). Therefore, reducing the rates of being overweight and obese will have benefits for all. Recently, new insights have indicated that microRNAs (miRNAs/miRs) serve a role in obesity and may be suitable therapeutic targets (3). miRNAs are a class of small endogenous non-coding RNAs that are involved in post-transcriptional gene repression (4). Epigenetic regulation of adipose functions mediated by miRNAs has emerged as an important mechanism in the study of energy metabolism and obesity in the last decade (5). Numerous miRNAs have been demonstrated to be associated with physiopathological disorders associated with obesity (6).

miR-1275, a 17 base pair (bp) intergenic microRNA, lies on chromosome 6 (7). A previous study demonstrated that miR-1275 was markedly down-regulated during maturation of human preadipocytes (8); less expression of miR-1275 was also observed in obese individuals compared with the non-obese ones (8). miR-1275 inhibits human visceral pre-adipocyte differentiation by silencing of ELK1, an E-twenty-six-domain transcription factor associated with adipocyte differentiation (2,8). These findings indicated that down-regulation of miR-1275 is involved in adipogenesis and obesity. Notably, lower levels of miR-1275 expression have been reported in some other diseases, such as hepatocellular carcinoma (9), breast cancer (10), coronary heart disease and some infections (11). These studies demonstrated that the down-regulation of miR-1275 is involved not only in obesity, but also in cancers and infections. However, little is known about the regulation of miR-1275 transcription. Further study is needed to determine how miR-1275 expression is down-regulated in obesity.

In obese individuals, adipose tissue is in a state of chronic, low-grade inflammation (12). Increased tumor necrosis factor (TNF)-α and interleukin (IL)-6 levels have been demonstrated to be notable markers of chronic inflammation in white adipose tissue (13). High levels of TNF-α and IL-6 are associated with the regulation of microRNA transcription in adipocytes (14). For instance, the expression of miR-146b in adipose tissue is up-regulated by TNF-α and IL-6 (15). It was therefore hypothesized that miR-1275 expression in adipose tissue may be regulated by TNF-α and IL-6. In the present study, a series of experiments were performed and the results confirmed the above hypothesis.

Materials and methods

Cell culture and treatment

Human visceral pre-adipocytes (ScienCell Research Laboratories, San Diego, CA, USA) were maintained in preadipocyte medium containing 5% fetal bovine serum, 1% preadipocyte growth supplement, and 1% penicillin/streptomycin solution (PAM, cat. no. 7211; all ScienCell Research Laboratories) at 37°C in an incubator under 5% CO2 and 95–100% humidity (16). To induce differentiation, serum-free PAM (containing 50 nM insulin, 100 nM dexamethasone, 0.5 mM 3-isobutyl-1-methylxanthine, and 100 mM rosiglitazone) was added to confluent human preadipocytes (day 0), and the medium was replaced every 2 days for the next 4 days. Thereafter, the medium was replaced with serum-free PAM containing 50 nM insulin and replaced every 2 days until lipid droplets had accumulated in cells (day 15) (17). Differentiated adipocytes were used for experiments 15 days later, when >80% of cells demonstrated morphological and biochemical properties of adipocytes. After an overnight incubation in serum-free PAM, human adipocytes were treated with a final concentration of 10 ng/ml TNF-α (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) or 30 ng/ml IL-6 (Sigma-Aldrich; Merck KGaA, Germany) for 0, 4, 8 or 24 h at 37°C in an incubator under 5% CO2 and 95–100% humidity (18). Human embryonic kidney 293T (HEK293T) cells were purchased from the American Type Culture Collection (Manassas, VA, USA) and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Bovogen Biologicals, Keilor East, Victoria, Australia). HEK293T cells were also incubated at 37°C in an incubator under 5% CO2 and 95–100% humidity (17).

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total miRNA from human adipocytes was extracted using an miRNeasyMiNi kit (Qiagen GmbH, Hilden, Germany). The quality of microRNA was assessed using 1% agarose gel electrophoresis and the concentration of microRNA was measured using spectrophotometry at 260 nm. Equal quantities of microRNA (200 ng) were used to synthesize cDNA using TaqMan microRNA Reverse Transcriptase kit (Applied Biosystems; Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer's protocol (Table I). qPCR with SYBR (Power SYBR™ Green PCR Master Mix; cat. no. 4368577; Thermo Fisher Scientific, Inc.) was carried out using an Applied Biosystems 7500 Sequence Detection system (ABI 7500 SDS; Thermo Fisher Scientific, Inc.) following manufacturer's protocol (Table II). Relative gene expression was quantified using the 2−ΔΔCq method (18). Total microRNA expression was normalized to small nuclear (sn)RNA U6. Primer cat. numbers are: 001973 for snRU6 and 002840 for miR-1275 (Applied Biosystems; Thermo Fisher Scientific Inc.).

Table I.

Temperature protocol for the microRNA reverse transcription.

Table I.

Temperature protocol for the microRNA reverse transcription.

StepTemp, °CTime, sec
Hold1630
Hold4230
Hold85  5
Hold  4  ∞

Table II.

qPCR protocol implemented in the present study.

Table II.

qPCR protocol implemented in the present study.

Cycling conditionTemp, °CTime, sec
Initial denaturation/hot start9530
Repeat steps 1–3 through 40 cycles
  Step 195  5
  Step 25810
  Step 37215
Bioinformatic analysis

Hsa-miR-1275 precursor (pri-miR-1275) sequence was obtained from Ensembl (http://www.asia.ensemble.org/index.html). The precursor sequence was numbered from +1 to +80, and therefore 1,500 bp upstream of pri-miR-1275 was considered to be the predicted promoter region. To identify the predicted binding sites of NF-κB, the sequence of the predicted promoter was uploaded to Genomatrix (http://www.genomatix.de), Jaspar (jaspar.genereg.net), and Promo_v3 (alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3), and the intersection of putative binding sites was recorded (19–21).

Plasmids and promoter reporter constructs

The predicted promoter region of miR-1275 was amplified by PCR with TaqDNA polymerase (cat. no. DR100A; Takara Biotechnology Co., Ltd., Dalian, China). DNA was amplified at 95°C for 40 sec for denaturation, 55°C for 35 sec for renaturation and 130 sec for elongation with 30 cycles. The site-specific mutation vectors aimed at the binding site of NF-κB were constructed by introducing point mutations with overlap-extension PCR. The predicted binding sites of NF-κB are presented in Table III. PCR products were then cloned into the dual-luciferase reporter plasmid PEZX-FR01 using MluI/BamHI restriction sites (GeneCopoeia Inc., Rockville, MD, USA). The primer sequences used are listed in Table IV.

Table III.

NF-κB binding sites predicted by Genomatrix, Jaspar and Promo_v3.

Table III.

NF-κB binding sites predicted by Genomatrix, Jaspar and Promo_v3.

SequencePosition fromToCore similarity on GenomatrixScore on JasparDissimilarity on Promo_v3 (%)
agaggTTCCcc−1,490−1,380   6.273.01
atagggccTTCCtcc   −947   −9330.926   5.80
ctaggggtTTCCttca   −806   −7920.97111.193.23
ctagggccTTCCttc   −782   −7680.926   4.35
ttgGGGAggccctgaa   −288   −2740.932   4.719.97

a Predicted by all three websites. Uppercase letters in a sequence indicate putative core binding sites of NF-κB. NF-κB, nuclear factor-κB.

Table IV.

Primers used in the present study.

Table IV.

Primers used in the present study.

PrimerSequences
Pro-1(−840 to +1)F: 5′-CAGAACATTTCTCTACTAGTACGCGTTCTTTGGCCAAAAGGACAAGGCAGGCA
AAAGTC-3′
R:5′-TTAGCATCGGCCATGGTGGCGGATCCAGTCCTTAGATGGTGATCTTGGTGAAGA
CCAAAG-3′
Pro-3(−240 to +1) F:5′-CAGAACATTTCTCTACTAGTACGCGTGGAGGGTCAGTTCCACTTCTTCTGTCTCCAC-3′
R:5′-TTAGCATCGGCCATGGTGGCGGATCCAGTCCTTAGATGGTGATCTTGGTGAAGACC-3′
Mut1 F:5′-CAGAACATTTCTCTACTAGTACGCGTTCTT-3′
R:5′-TTAGCATCGGCCATGGTGGCGGATCCAGTCCTTAGATGGTGATCTTGGTGAAGACC
AAAGAC-3′
Mut2 F:5′-CAGAACATTTCTCTACTAGTACGCGTTCTTTGGCCAAAAGGACAAGGCAGGCAA
AAGTCT-3′
R: 5′-TTAGCATCGGCCATGGTGGCGGATCCAGTCCTTAGATGGTGATCTTGGTGAAGACC
AAAGAC-3′
Mut3F: 5′-CAGAACATTTCTCTACTAGTACGCGTTCTT-3′
R:5′-TTAGCATCGGCCATGGTGGCGGATCCAGTCCTTAGATGGTGATCTTGGTGAAGACC
AAAGAC-3′

[i] F, forward; R, reverse.

Dual-luciferase assays

HEK293T cells were cultured in 24-well plates at density of 2×104 cells/well. When grown to a density of 60–70%, they were transfected with 2 µg/well reporter plasmids and 6-µl/well Lipofectamine (Invitrogen; Thermo Fisher Scientific Inc.) for 6 h. Empty PEZX-FR01 plasmid served as a control. Following this, cells were washed with serum-free medium and treated with the NF-κB activator TNF-α (10 ng/ml) for 24 h. For the rescue assay, HEK293T cells were treated with the NF-κB inhibitor 4-methyl-N1-(3-phenyl-propyl) -benzene-1,2-diamine (10 µM; Calbiochem; Merck KGaA) for 1 h. Subsequently, cells were washed with serum-free medium and treated with TNF-α (10 ng/ml) for 24 h. After this, luciferase activity was analyzed using a dual luciferase reporter assay (Promega Corporation, Madison, WI, USA) with a GloMax 96 Microplate Luminometer E6501 (Promega Corporation) (22). Firefly luciferase activity was normalized to the Renilla luciferase activity.

Statistical analysis

The data were analyzed using SPSS version 17.0 (SPSS Inc., Chicago, IL, USA). All data are presented as the mean ± standard deviation. Statistical analysis was performed using one-way analysis of variance followed by Dunnett's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of miR-1275 in human adipocytes treated with TNF-α or IL-6

Human mature adipocytes were treated with 10 ng/ml TNF-α or 30 ng/ml IL-6 for 24 h, and the expression of miR-1275 was examined at different times (0, 4, 8 and 24 h). The expression of miR-1275 was normalized to the expression of snRU6. After treatment with TNF-α, miR-1275 relative expression was significantly lower than in untreated control cells (Fig. 1A). A similar reduction in miR-1275 expression was also observed in human adipocytes treated with IL-6 (Fig. 1B). These results indicated that TNF-α and IL-6 could regulate the expression of miR-1275 in human adipocytes.

Figure 1.

Relative expression levels of miR-1275 in human adipocytes treated with (A) TNF-α and (B) IL-6. Data are presented as the mean ± standard deviation of 3 independent experiments. **P<0.01, *P<0.05 vs. 0 h. miR, micro-RNA; NF-κB, nuclear factor-κB; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; snRU6, small nuclear RU6.

Prediction of promoter regions of miR-1275

Bioinformatic analysis was performed on the 1,500 bp upstream sequence of pri-miR-1275 to further determine how TNF-α and IL-6 regulate miR-1275 expression. Several binding sites of NF-κB, the downstream transcription factor of TNF-α and IL-6, were identified on the 1,500 bp sequence of the predicted promoter. This suggested that TNF-α and IL-6 may regulate miR-1275 expression through NF-κB. To locate the strongest binding site of NF-κB, the sequence of putative promoters was submitted to the following websites: Genomatrix, Jaspar and Promo_v3. Two sites (from −806 to −792 and from-288 to-274) were predicted by all three websites (Table II). Therefore, these were chosen to be the strongest binding sites of NF-κB (Fig. 2).

Figure 2.

Prediction of miR-1275 promoter region. (A) An upstream sequence of 840 bp, including the two strongest binding sites of NF-κB, was predicted to be the promoter regions of miR-1275. (B) Schematic diagram of the predicted miR-1275 promoter region. miR, micro-RNA; NF-κB, nuclear factor-κB.

Confirmation of NF-κB binding sites on the promoter region of miR-1275

To determine whether the two predicted binding sites were functional, different promoters were made and their activity was examined in HEK293T cells. For the deletion assay (Fig. 2A), dual-luciferase reporter plasmids PEZX-FR01 of Pro-1 (including both sites), Pro-2 (only including the-288 site) and Pro-3 (including neither site) were transfected into HEK293T cells. Pro-1 demonstrated >10 times higher luciferase activity compared with the empty reporter plasmids, whereas Pro-2 and Pro-3 showed similar luciferase activity compared with the control (Fig. 3A). These results suggested that the sequence from −840 to +1 was the promoter region of miR-1275, and the −806 site was necessary for the promoter's activity (Fig. 3B and C).

Figure 3.

Luciferase activity of miR-1275 promoter region with and without the NF-κB binding sites. (A) Schematic diagram of the predicted promoter region of miR-1275. (B) Schematic diagrams of the plasmids used in the deletion assay. (C) Dual-luciferase activity of reporter plasmids PEZX-FR01 of Pro-1, Pro-2 and Pro-3. Data are presented as the mean ± standard deviation. **P<0.01 vs. control. miR, micro-RNA; NF-κB, nuclear factor-κB.

To confirm the role of −288 site, the core binding sequences of the −806 and −288 sites were mutated (Fig. 4A and B). The luciferase activities of Mut-1 (mutation on-806 site), Mut-2 (mutation on-288 site) and Mut-3 (mutation on both-806 and-288 sites) demonstrated no difference compared with the empty reporter plasmids (Fig. 4C). These results suggested that the −288 site was also necessary for the promoter activity.

Figure 4.

Luciferase activity of the promoter region of miR-1275 with mutation on binding sites of NF-κB. (A) Schematic diagram of the predicted promoter region of miR-1275. (B) Schematic diagrams of mutations of the promoter region of miR-1275′s promoter region used in the delete assay. (C) Dual-luciferase activity (F/R) of Mut-1, Mut-2 and Mut-3 in HEK293T cells. Data are presented as the mean ± standard deviation. TNF-α, tumor necrosis factor-α; miR, micro-RNA; mut, mutation; NF-κB, nuclear factor-κB; F, Firefly; R, Renilla.

Effects of TNF-α and JSH-23 on miR-1275 promoter activity

To confirm the above-mentioned results, a rescue assay was performed. HEK293T cells were transfected by Pro-1-PEZX-FR01 and then treated with JSH-23 before treatment with TNF-α. As presented in Fig. 5, cells treated with JSH-23 and TNF-α demonstrated significantly more luciferase activity than cells treated with TNF-α alone. These results confirmed that TNF-α decreased miR-1275 promoter activity through NF-κB.

Figure 5.

Luciferase activity of the promoter region of miR-1275 treated with TNF-α, JSH-23, or both. The relative luciferase activity (F/R) of the control group was normalized to 1.00. Data are presented as the mean ± standard deviation. **P<0.01 vs. control group. TNF-α, tumor necrosis factor-α; miR, micro-RNA; F, Firefly; R, Renilla.

Discussion

A previous study has demonstrated that miR-1275 is markedly down-regulated during differentiation and maturation of human preadipocytes by miRNA expression microarrays (8). Reduced miR-1275 expression in obese individuals compared with non-obese individuals has been observed. Additionally, miR1275 has been reported to be dysregulated in certain types of cancer and infection (23). Fawzy et al (7) reported that miR-1275 expression is downregulated cirrhotic and cancerous liver tissue. However, the exact mechanism is currently unclear.

In the present study, miR-1275 expression was downregulated by >60% in response to TNF-α and by 50% in response to IL-6 in mature adipocytes, which suggested that inflammatory cytokines could serve an important role in regulating miR-1275 expression in adipocytes. Obesity is characterized by increased production of cytokines such as IL-6, IL-1, and TNF-α (24). The role of miRNAs in inflamed adipose tissues has been highlighted in several studies (14). Shi et al (17) reported that IL-6 and TNF-α induce obesity-associated inflammatory responses through transcriptional regulation of miR-146b. Another study also demonstrated Mir-335 to be involved in adipose tissue inflammation (25). The present study was consistent with previous ones. It has confirmed that miR-1275 may be downregulated by TNF-α and IL-6. The role of TNF-α and IL-6 in regulating miR-1275, luciferase assays and rescue experiments were implemented based on bioinformatics analysis.

NF-κB is a downstream transcription factor of TNF-α and IL-6 (26). TNF-α activates NF-κB by enhancing nuclear translocation of P65, which is the active subunit of NF-κB (27,28). Promoter analysis of the miR-146a gene revealed that NF-κB serves a critical role in inducing its transcription by LPS, TNF-α, and IL-1 (29). miR-335 is also proved to be up-regulated by TNF-α and IL-6 through the NF-κB signaling pathway in adipocytes (25). Previous studies have also demonstrated that let-7 and miR-365 are under the control of NF-κB (30,31). To determine whether NF-κB is involved in regulating miR-1275, a 1,500 bp upstream sequence of miR-1275 was uploaded to Jaspar, a database that uses a transcription factor flexible models to predict transcription factors of a given sequence (19). Notably, 23 sites were predicted as binding sites of NF-κB. To confirm the results, the 1,500 bp upstream sequence of miR-1275 was submitted to Genomatix and Promo_v3 (20,21), and the intersection of binding sites predicted by the three databases was taken (Table II. The region from −806 to-792 (here called site-806) and the region from-288 to-274 (here called site-288) were predicted by all three databases.

A total of six different sequences, termed Pro-1, Pro-2, Pro-3, Mut-1, Mut-2 and Mut-3, were designed to assess the promoter activity of sites-806 and-288. Pro-1 (which has both sites) demonstrated >10 times higher luciferase activity compared with empty reporter plasmids, whereas Pro-2 and Pro-3 demonstrated equal luciferase activity compared with the control. Luciferase activities of Mut-1 (mutation at site −806), Mut-2 (mutation at site −288) and Mut-3 (mutations at both sites) demonstrated no difference compared with the empty reporter plasmids. These results illustrated that both sites are necessary for promoter activity. These data also indicated that NF-κB was involved in the transcription of miR-1275 by binding to sites-806 and-288. The next step was to prove whether NF-κB participates in the regulation of miR-1275 by TNF-α.

HEK293T cells were transfected with Pro-1-PEZX-FR01 and were then treated with JSH-23 prior to TNF-α. TNF-α dramatically decreased promoter activity of Pro-1, while cells treated with JSH-23 and TNF-α demonstrated significantly higher luciferase activity compared with cells treated with TNF-α alone. This meant that JSH-23 could partially reverse the down-regulation of the promoter activity of Pro-1 caused by TNF-α. JSH-23 is an NF-κB inhibitor and acts by inhibiting NF-κB/P65 nuclear translocation (32,33). Notably, a potential mechanism could be the following: In response to TNF-α, with the nuclear translocation of NF-Κb/P65, NF-κB is activated via NF-Κb/P65 nuclear translocation which then binds to sites-806 and-288 of the miR-1275 promoter region. This leads to inhibiting miR-1275 transcription. Other studies have illustrated a similar association between NF-κB activation and miRNA downregulation. Sasaki and Vageli (34) have reported lower levels of miR-34a, −451a and-375 in response to NF-κB activation; miR-1908 was also down-regulated when NF-κB was bound to its promoter region (22).

In conclusion, the present results demonstrated that miR-1275 expression in mature human adipocytes can be down-regulated by TNF-α and IL-6. NF-κB was proven to be involved in the regulation of miR-1275 transcription by binding to its promoter region. In response to TNF-α, NF-κB was bound to promoter region of miR-1275 and inhibited its transcription. This may partially explain the down-regulation of miR-1275 in mature human adipocytes. More studies are required to explore whether miR-1275 could be a therapeutic target for obesity.

Acknowledgements

The present study was supported by the Nanjing Medical University (grant no. 2013NJMU0027), the Education Department of Jiangsu Province (grant nos. 13KJB20014 and JX10617801), and the National Natural Science Foundation of China (grant no. 81300706). The authors would like to thank LetPub (http://www.letpub.com) for its linguistic assistance during the preparation of this manuscript.

References

1 

World Health Organization, . Obesity and Overweight Fact Sheet. June. 2016http://www.who.int/mediacentre/factsheets/fs311/en/3–August. 2016

2 

Sandfort V, Lai S, Ahlman MA, Mallek M, Liu S, Sibley CT, Turkbey EB, Lima JA and Bluemke DA: Obesity is associated with progression of atherosclerosis during statin treatment. J Am Heart Assoc. 5(pii): e0036212016. View Article : Google Scholar : PubMed/NCBI

3 

Peng Y, Yu S, Li H, Xiang H, Peng J and Jiang S: MicroRNAs: Emerging roles in adipogenesis and obesity. Cell Signal. 26:1888–1896. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Ambros V: The functions of animal microRNAs. Nature. 431:350–355. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Abente EJ, Subramanian M, Ramachandran V and Najafi-Shoushtari SH: MicroRNAs in obesity-associated disorders. Arch Biochem Biophys. 589:108–119. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Yang L, Shi CM, Chen L, Pang LX, Xu GF, Gu N, Zhu LJ, Guo XR, Ni YH and Ji CB: The biological effects of hsa-miR-1908 in human adipocytes. Mol Biol Rep. 42:927–935. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Fawzy IO, Hamza MT, Hosny KA, Esmat G, El Tayebi HM and Abdelaziz AI: miR-1275: A single microRNA that targets the three IGF2-mRNA-binding proteins hindering tumor growth in hepatocellular carcinoma. FEBS Lett. 589:2257–2265. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Pang L, You L, Ji C, Shi C, Chen L, Yang L, Huang F, Zhou Y, Zhang J, Chen X and Guo X: MiR-1275 inhibits adipogenesis via ELK1 and its expression decreases in obese subjects. J Mol Endocrinol. 57:33–43. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Das K, Saikolappan S and Dhandayuthapani S: Differential expression of miRNAs by macrophages infected with virulent and avirulent Mycobacterium tuberculosis. Tuberculosis (Edinb). 93 Suppl:S47–S50. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Katsushima K, Shinjo K, Natsume A, Ohka F, Fujii M, Osada H, Sekido Y and Kondo Y: Contribution of microRNA-1275 to Claudin11 protein suppression via a polycomb-mediated silencing mechanism in human glioma stem-like cells. J Biol Chem. 287:27396–27406. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Akamatsu S, Hayes CN, Tsuge M, Miki D, Akiyama R, Abe H, Ochi H, Hiraga N, Imamura M, Takahashi S, et al: Differences in serum microRNA profiles in hepatitis B and C virus infection. J Infect. 70:273–287. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Dandona P, Aljada A and Bandyopadhyay A: Inflammation: The link between insulin resistance, obesity and diabetes. Trends Immunol. 25:4–7. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Hotamisligil GS, Arner P, Caro JF, Atkinson RL and Spiegelman BM: Increased adipose tissue expression of tumor necrosis factor-alpha in human obesity and insulin resistance. J Clin Invest. 95:2409–2415. 1995. View Article : Google Scholar : PubMed/NCBI

14 

Karkeni E, Astier J, Tourniaire F, El Abed M, Romier B, Gouranton E, Wan L, Borel P, Salles J, Walrand S, et al: Obesity-associated inflammation induces microRNA-155 expression in adipocytes and adipose tissue: Outcome on adipocyte function. J Clin Endocrinol Metab. 101:1615–1626. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Chen L, Dai YM, Ji CB, Yang L, Shi CM, Xu GF, Pang LX, Huang FY, Zhang CM and Guo XR: MiR-146b is a regulator of human visceral preadipocyte proliferation and differentiation and its expression is altered in human obesity. Mol Cell Endocrinol. 393:65–74. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Xu LL, Shi CM, Xu GF, Chen L, Zhu LL, Zhu L, Guo XR, Xu MY and Ji CB: TNF-alpha, IL-6 and leptin increase the expression of miR-378, an adipogenesis-related microRNA in human adipocytes. Cell Biochem Biophys. 70:771–776. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Shi C, Zhu L, Chen X, Gu N, Chen L, Zhu L, Yang L, Pang L, Guo X, Ji C and Zhang C: IL-6 and TNF-α induced obesity-related inflammatory response through transcriptional regulation of miR-146b. J Interferon Cytokine Res. 34:342–348. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Mathelier A, Fornes O, Arenillas DJ, Chen CY, Denay G, Lee J, Shi W, Shyr C, Tan G, Worsley-Hunt R, et al: JASPAR 2016: A major expansion and update of the open-access database of transcription factor binding profiles. Nucleic Acids Res. 44:D110–D115. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Kaur S, Anjali G, Bhardwaj P, Taneja J and Singh R: Data in support of FSH induction of IRS-2 in human granulosa cells: Mapping the transcription factor binding sites in human IRS-2 promoter. Data Brief. 6:162–167. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Farré D, Roset R, Huerta M, Adsuara JE, Roselló L, Albà MM and Messeguer X: Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res. 31:3651–3653. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Kuang Q, Li J, You L, Shi C, Ji C, Guo X, Xu M and Ni Y: Identification and characterization of NF-kappaB binding sites in human miR-1908 promoter. Biomed Pharmacother. 74:158–163. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Parafioriti A, Bason C, Armiraglio E, Calciano L, Daolio PA, Berardocco M, Di Bernardo A, Colosimo A, Luksch R and Berardi AC: Ewing's sarcoma: An analysis of miRNA expression profiles and target genes in paraffin-embedded primary tumor tissue. Int J Mol Sci. 17(pii): E6562016. View Article : Google Scholar : PubMed/NCBI

24 

Hotamisligil GS: Inflammation and metabolic disorders. Nature. 444:860–867. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Zhu L, Chen L, Shi CM, Xu GF, Xu LL, Zhu LL, Guo XR, Ni Y, Cui Y and Ji C: MiR-335, an adipogenesis-related microRNA, is involved in adipose tissue inflammation. Cell Biochem Biophys. 68:283–290. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Ozes ON, Mayo LD, Gustin JA, Pfeffer SR, Pfeffer LM and Donner DB: NF-kappa B activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature. 401:82–85. 1999. View Article : Google Scholar : PubMed/NCBI

27 

Wang D and Baldwin AS Jr: Activation of nuclear factor-kappaB-dependent transcription by tumor necrosis factor-alpha is mediated through phosphorylation of RelA/p65 on serine 529. J Biol Chem. 273:29411–29416. 1998. View Article : Google Scholar : PubMed/NCBI

28 

Chen LF and Greene WC: Shaping the nuclear action of NF-kappa B. Nat Rev Mol Cell Bio. 5:392–401. 2004. View Article : Google Scholar

29 

Taganov KD, Boldin MP, Chang KJ and Baltimore D: NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc Natl Acad Sci USA. 103:12481–12486. 2006; View Article : Google Scholar : PubMed/NCBI

30 

Iliopoulos D, Hirsch HA and Struhl K: An epigenetic switch involving NF-kappaB, Lin28, Let-7 MicroRNA and IL6 links inflammation to cell transformation. Cell. 139:693–706. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Xu Z, Xiao SB, Xu P, Xie Q, Cao L, Wang D, Luo R, Zhong Y, Chen HC and Fang LR: miR-365, a novel negative regulator of interleukin-6 gene expression, is cooperatively regulated by Sp1 and NF-kappaB. J Biol Chem. 286:21401–21412. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Borghi A, Verstrepen L and Beyaert R: TRAF2 multitasking in TNF receptor-induced signaling to NF-κB, MAP kinases and cell death. Biochem Pharmacol. 116:1–10. 2016. View Article : Google Scholar : PubMed/NCBI

33 

Vranková S, Barta A, Klimentová J, Dovinová I, Líšková S, Dobešová Z, Pecháňová O, Kuneš J and Zicha J: The regulatory role of nuclear factor Kappa B in the heart of hereditary hypertriglyceridemic rat. Oxid Med Cell Longev. 2016:98140382016. View Article : Google Scholar : PubMed/NCBI

34 

Sasaki CT and Vageli DP: miR-21, miR-155, miR-192, and miR-375 deregulations related to NF-kappaB activation in gastroduodenal fluid-induced early preneoplastic lesions of laryngeal mucosa in vivo. Neoplasia. 18:329–338. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhou YF, Fu ZY, Chen XH, Cui Y, Ji CB and Guo XR: Tumor necrosis factor‑α and interleukin‑6 suppress microRNA‑1275 transcription in human adipocytes through nuclear factor‑κB. Mol Med Rep 16: 5965-5971, 2017.
APA
Zhou, Y., Fu, Z., Chen, X., Cui, Y., Ji, C., & Guo, X. (2017). Tumor necrosis factor‑α and interleukin‑6 suppress microRNA‑1275 transcription in human adipocytes through nuclear factor‑κB. Molecular Medicine Reports, 16, 5965-5971. https://doi.org/10.3892/mmr.2017.7392
MLA
Zhou, Y., Fu, Z., Chen, X., Cui, Y., Ji, C., Guo, X."Tumor necrosis factor‑α and interleukin‑6 suppress microRNA‑1275 transcription in human adipocytes through nuclear factor‑κB". Molecular Medicine Reports 16.5 (2017): 5965-5971.
Chicago
Zhou, Y., Fu, Z., Chen, X., Cui, Y., Ji, C., Guo, X."Tumor necrosis factor‑α and interleukin‑6 suppress microRNA‑1275 transcription in human adipocytes through nuclear factor‑κB". Molecular Medicine Reports 16, no. 5 (2017): 5965-5971. https://doi.org/10.3892/mmr.2017.7392
Copy and paste a formatted citation
x
Spandidos Publications style
Zhou YF, Fu ZY, Chen XH, Cui Y, Ji CB and Guo XR: Tumor necrosis factor‑α and interleukin‑6 suppress microRNA‑1275 transcription in human adipocytes through nuclear factor‑κB. Mol Med Rep 16: 5965-5971, 2017.
APA
Zhou, Y., Fu, Z., Chen, X., Cui, Y., Ji, C., & Guo, X. (2017). Tumor necrosis factor‑α and interleukin‑6 suppress microRNA‑1275 transcription in human adipocytes through nuclear factor‑κB. Molecular Medicine Reports, 16, 5965-5971. https://doi.org/10.3892/mmr.2017.7392
MLA
Zhou, Y., Fu, Z., Chen, X., Cui, Y., Ji, C., Guo, X."Tumor necrosis factor‑α and interleukin‑6 suppress microRNA‑1275 transcription in human adipocytes through nuclear factor‑κB". Molecular Medicine Reports 16.5 (2017): 5965-5971.
Chicago
Zhou, Y., Fu, Z., Chen, X., Cui, Y., Ji, C., Guo, X."Tumor necrosis factor‑α and interleukin‑6 suppress microRNA‑1275 transcription in human adipocytes through nuclear factor‑κB". Molecular Medicine Reports 16, no. 5 (2017): 5965-5971. https://doi.org/10.3892/mmr.2017.7392
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team