Open Access

WNT5A, β‑catenin and SUFU expression patterns, and the significance of microRNA deregulation in placentas with intrauterine growth restriction

  • Authors:
    • Ida Marija Sola
    • Valentina Karin‑Kujundzic
    • Frane Paic
    • Lada Lijovic
    • Mislav Glibo
    • Nikola Serman
    • Tihana Duic
    • Anita Skrtic
    • Krunoslav Kuna
    • Semir Vranic
    • Ljiljana Serman
  • View Affiliations

  • Published online on: December 13, 2022     https://doi.org/10.3892/mmr.2022.12914
  • Article Number: 28
  • Copyright: © Sola et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Placental insufficiency is a common cause of intrauterine growth restriction (IUGR). It affects ~10% of pregnancies and increases fetal and neonatal morbidity and mortality. Although Wnt and Hh pathways are crucial for embryonic development and placentation, their role in the pathology of IUGR is still not sufficiently explored. The present study analyzed the expression of positive regulators of the Wnt pathway, WNT5A and β‑catenin, and the expression of the Hh pathway negative regulator suppressor of fused (SUFU). Immunohistochemical and reverse transcription‑quantitative PCR (RT‑qPCR) assays were performed on 34 IUGR and 18 placental tissue samples from physiologic singleton‑term pregnancies. Epigenetic mechanisms of SUFU gene regulation were also investigated by methylation‑specific PCR analysis of its promoter and RT‑qPCR analysis of miR‑214‑3p and miR‑378a‑5p expression. WNT5A protein expression was higher in endothelial cells of placental villi from IUGR compared with control tissues. That was also the case for β‑catenin protein expression in trophoblasts and endothelial cells and SUFU protein expression in trophoblasts from IUGR placentas. The SUFU gene promoter remained unmethylated in all tissue samples, while miR‑214‑3p and miR‑378a‑5p were downregulated in IUGR. The present results suggested altered Wnt and Hh signaling in IUGR. DNA methylation did not appear to be a mechanism of SUFU regulation in the pathogenesis of IUGR, but its expression could be regulated by miRNA targeting.

Introduction

Intrauterine growth restriction (IUGR) (or fetal growth restriction-FGR) implies fetal incapability to achieve its genetically determined growth potential. The American College of Obstetricians and Gynecologists (ACOG) and Society for Maternal-Fetal Medicine (SMFM) define IUGR based on a sonographic finding of estimated fetal weight (EFW) or abdominal circumference (AC) below the 10th centile for gestation age (1) and is diagnosed in about 10% of pregnancies (2). IUGR is a heterogeneous entity since the growth restriction could be caused by fetal, maternal, or placental pathology with possible common overlapping. Abnormal placentation and placental vascular disease lead to chronic uteroplacental hypoxia and IUGR (2). Our interest is IUGR due to uteroplacental insufficiency and dysfunction since the placental origin is the most common cause of late-onset IUGR (3). Adequate diagnosis and appropriate pregnancy monitoring and delivery timing of growth-restricted fetuses are essential because of the increased risk of fetal and neonatal morbidity and mortality. That said, perinatal mortality with IUGR is 6- to 10- fold increased (4). Also, numerous studies found that infants born with IUGR had an increased risk for neurodevelopmental abnormalities and lower cognitive performance (57).

The specific pattern of balanced differentiation of various trophoblastic cell types is crucial for normal placentation (8,9), and numerous studies reported a decisive role of appropriate Wingless (Wnt) signaling in normal placental development (1012).

Wnt canonical pathway is an evolutionary conserved cell-signaling system essential for the regulation of cell differentiation, migration, invasion, and apoptosis (13), thus contributing to multiple organ system development (1417). Consequently, abnormal Wnt signaling has been reported in various diseases and abnormalities such as pregnancy-related diseases-preeclampsia or IUGR (18), birth defects, different malignancies (1922) and the pathophysiology of various neuropsychiatric disorders (23). β-catenin is a cytoplasmic protein with an essential role in Wnt canonical signaling pathway. Wnt ligands activate Wnt signaling. WNT5A is one of these ligands that plays a critical role in convergent extension (CE), epithelial-mesenchymal transition (EMT), and planar cell polarity (PCP) regulation during the embryonic period (24). Once Wnt ligand binds to the transmembrane Frizzled (Fz) receptor and LRP5 and LRP6 co-receptors (lipoprotein receptor-related protein 5 and 6), cytoplasmic Dishevelled (DVL) protein activates and degrades the APC (adenomatous polyposis coli)/Axin/CK1a (casein kinase 1a)/GSK3ß (glycogen synthase kinase 3b) destruction complex causing the stabilization and accumulation of β-catenin in the cytoplasm, in an active, non-phosphorylated form. Accumulated β-catenin then migrates to the nucleus. It associates to TCF/LEF (T-cell factor/lymphoid-enhanced binding factor) family of transcription factors that subsequently activate the target genes' transcription. In the absence of Wnt ligands, when Wnt canonical pathway is not activated, the APC/Axin/CK1a/GSK3ß destruction complex binds to β-catenin, causing the phosphorylation (i.e., inactivation) of β-catenin and its proteasomal degradation.

The Hh signaling pathway also has a decisive role during embryonic development due to its function in trophoblast EMT (25), cell growth and patterning (26), angiogenesis and vasculogenesis, as well as various tissue and organ systems development (27,28).

Signaling begins when one of three Hedgehog homologs, Indian (IHH), Desert (DHH) or Sonic (SHH), binds to the membrane Patched receptor (PTCH), and then seven transmembrane spanning protein Smoothened (SMO) initiates a signaling cascade and activates GLI (glioma-associated oncogene) transcription factors and target genes. Suppressor of fused (SUFU) exerts its function as an essential negative regulator of the Hh signaling pathway by binding to GLI, thus causing phosphorylation and inactivation of GLI and further signaling. Min et al (29) demonstrated that SUFU could be a negative regulator of the Wnt and Hh signaling pathways, showing a potentially strong linkage between these pathways. This could be very significant since SUFU might be an essential link between the two pathways and their crosstalk.

DNA methylation is one of the most important and well-studied DNA epigenetic modifications that have a decisive role in placental development. Altered placental methylation patterns have been associated with the disruption of placental morphology and linked to pregnancy pathology (30). It has been shown that treating pregnant rats with DNA methyltransferase inhibitor (5azaC) at different stages of pregnancy results in altered trophoblast proliferative activity, disruption of placental structure, and reduced placental weight (31). The altered DNA methylation patterns have also been reported in placentas from pregnancies with underlying placental pathologies such as preeclampsia or IUGR (32). Also, another study found growth-related WNT2 gene promoter methylation to be associated with low birth weight (33). Based on the knowledge of the importance of DNA methylation in regulating gene expression in the placenta and the fact that it is the best known and studied epigenetic modification, we wanted to elucidate if this mechanism also regulates the SUFU gene expression.

MicroRNAs (miRNAs), a class of small (19–25 nucleotides) evolutionary conserved endogenous single-stranded non-coding RNAs, also play an important role in epigenetic regulation of gene expression. They prevent protein production in a sequence-specific manner by participating in either cleavage and degradation or translation inhibition of target mRNAs (3436). Up to now, aberrant expression of regulatory miRNAs has been associated with the initiation and progression of various pathological processes (3739). Recent evidence also highlights their regulatory roles in human fetoplacental growth (4043). Some of them, such as miR-214 and miR-378, have also regulated the Hh signaling pathway (4446).

Based on these assumptions and since the role of the Wnt and Hh signaling pathways is still insufficiently explored in the placenta and IUGR, we wanted to investigate the expression of WNT5A, β-catenin, and SUFU in placentas from IUGR and gather more information regarding the role of these pathways in placental pathology related to IUGR. Also, our study aimed to explore if DNA methylation and miR-214-3p and miR-378-5p targeting could be epigenetic mechanisms involved in regulating SUFU gene expression in placentas.

To our knowledge, up to date, SUFU gene methylation status and the status of miR-214-3p and miR-378-5p in the term IUGR placentas have not been reported.

Materials and methods

Tissue samples

The samples used in the study were a part of a collection of placental tissue samples belonging to the University of Zagreb School of Medicine. They were collected in collaboration with the University Hospital ‘Merkur’ Zagreb. Both institutions are parts of the Scientific Center of Excellence for Reproductive and Regenerative Medicine (CERRM).

In the examination of placentation, a control group consisted of eighteen formalin-fixed paraffin-embedded (FFPE) placentas, obtained from physiological singleton complication-free pregnancies, delivered at term (between 38 and 42 weeks of gestation) of a newborn with normal body weight (between 10th and 90th percentile for gestational age, newborn sex, and mother's parity). The experimental group consisted of 34 term placentas from pathological pregnancies with IUGR based on serial ultrasound measurements of fetal biparietal diameter (BPD), head and abdominal circumference (HC and AC, respectively), and femur length (FL), with the assessment of the bodyweight below 10th percentile for the duration of pregnancy, fetal sex, mother's parity, and confirmed at birth by measuring newborn body weight. The only pregnancy pathology that was included in the study was IUGR. Exclusion criteria for pathological pregnancies and controls were as follows: Multiple pregnancies, tobacco and drug use, intrauterine viral infections (TORCH and Parvovirus B19), chorioamnionitis, hypertension, preeclampsia, fetal malformations, and genetic abnormalities as well as autoimmune diseases or eating disorders of the mother. The board-certified pathologist (A.S.) examined each placenta and rendered the diagnosis. A disc-shaped tissue sample comprising an entire thickness of the placenta from the fetal to maternal side, about 5 cm from the umbilical cord, was taken from each placenta.

Immunohistochemistry (IHC)

IHC was performed on 34 IUGR placentas and 18 control placentas. FFPE tissue sections (4 µm thickness) were placed on silanized glass slides (DakoCytomation) and analyzed by immunohistochemistry as previously described (47). Antigen retrieval was performed by heating the sections in Dako Target Retrieval Solution (Dako Corporation) in a steamer for 20 min. Sections were incubated with primary antibody overnight at 4°C. Dako REAL Envision detection system (cat. no. K0679; Dako; Agilent Technologies, Inc.) was utilized for visualization as suggested by the manufacturer, and the sections were counterstained with hematoxylin at room temperature (RT) for 1 min. The following primary antibodies were used: anti-WNT5A (mouse monoclonal anti-human; Cat. No. ab86720, Abcam, dilution 1:1,000), anti-β-catenin (rabbit polyclonal anti-human; Cat. No. ab16051, Abcam, dilution 1:500) and anti-SUFU (rabbit polyclonal anti-human; Cat. No. 26759-1-AP, Proteintech, dilution 1:500). Tonsils (WNT5A), colon tissue (β-catenin), and kidney (SUFU) were used as positive controls. Negative control was treated the same way with the omission of incubation with primary antibodies.

The expression pattern of WNT5A, β-catenin, and SUFU in placentas was interpreted independently by two pathologists (S.V., A.S.) as follows: 0 if no staining was observed; 1 if <10% cells were stained; 2 if 10–50% cells were stained; and 3 if >50% cells were stained (48). Protein expression was observed in trophoblasts, stromal cells, and endothelial cells. In discordant interpretations, the pathologists reviewed cases together to obtain an agreement.

Methylation-specific PCR (MSP)

DNA was isolated from two 10 µm sections of FFPE control placental tissue (n=14) and IUGR placental tissue (n=10) as previously described (49) and treated with bisulfite using the MethylEdge Bisulfite Conversion System (Promega, Madison, Wisconsin, USA) according to the instructions from the manufacturer. Bisulfite-treated DNA was used for methylation-specific PCR reaction (MSP). Primers for SUFU promoter region (Table I) were synthesized according to Paluszczak et al (50). All PCRs were performed using TaKaRa EpiTaq HS (for bisulfite-treated DNA) (TaKaRa Bio): 1XEpiTaq PCR Buffer (Mg2+ free), 2.5 mM MgCl2, 0.3 mM dNTPs, 10 pmol of each primer (Sigma-Aldrich), 25 ng of DNA, and 0.75 Units of TaKaRa EpiTaq HS DNA Polymerase in a 25 µl final reaction volume. PCR cycling conditions were as follows: initial denaturation at 95°C for 30 sec, followed by 40 cycles consisting of three steps: 95°C for 30 sec, the respective annealing temperature for 30 sec, 72°C for 30 sec, followed by a final extension at 72°C for 7 min. For the amplification of the methylated SUFU promoter region, the annealing temperature was 58°C, while for the unmethylated SUFU promoter region was 55°C. PCR products were separated on 2% agarose gel stained with GelStar nucleic acid stain (Lonza Rockland, Inc.) and visualized on a UV transilluminator. Methylated Human Control (Promega) was used as a positive control for methylated reaction, and unmethylated human EpiTect Control DNA (Qiagen) was used as a positive control for unmethylated reaction, and nuclease-free water was used as a negative control.

Table I.

Primer sequences for MSP and RT-qPCR.

Table I.

Primer sequences for MSP and RT-qPCR.

Targeted geneAccession numberForward primer (5′-3′)Reverse primer (5′-3′)Product length, bp
MSP primers
  SUFUNC_000010.11 GTTTCGGGGAGTTTTATTTATC GAAAACCGAAAAAACAATCG180
  methylated
  SUFUNC_000010.11 GTTTTGGGGAGTTTTATTTATTGA AAACAAAAACCAAAAAAACAATCA183
  unmethylated
RT-qPCR
primers
  WNT5ANM_003392.7 GCACCAGAGCAGACAACC TCACAACACGGAGGAATCAG89
  SUFUNM_016169.4 GCTGCTGACAGAGGACCCACA GTGCAGACACCAACGATCTGGA84
  CTNNB1NM_001904.4 TGCGTACTGTCCTTCGGGCT ATGGCAGGCTCAGTGATGTCT52
  GAPDHNM_002046.7 TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG87

[i] CTNNB1, catenin β1; MSP, methylation-specific PCR; RT-qPCR, reverse transcription-quantitative PCR; SUFU, suppressor of fused.

RNA extraction, reverse transcription, and RT-qPCR

For mRNA analysis, total RNA was isolated from five consecutive 5-µm thick sections of FFPE control placental tissue (n=14) and IUGR placental tissue (n=14). Shortly, all tissue sections were deparaffinized by incubation in 1.0 ml xylene (Invitrogen; Thermo Fisher Scientific, Inc.) for 3 min at 50°C, followed by centrifugation (three times for 5 min at RT at 12,000 × g each). The supernatant was then discarded, and the obtained tissue pellet was washed three times with 1.0 ml absolute ethanol and subsequently incubated overnight at 55°C in 350 µl of protease K digestion buffer (20 mM Tris-HCl pH 8.0; 1 mM CaCl2; 0.5% sodium dodecyl sulfate and 500 µg/ml protease K; all reagents were obtained from Sigma-Aldrich; Merck KGaA). Total RNA was isolated using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's recommended procedure. The purity and quantity of total RNA were evaluated using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). Subsequently, one µg of total RNA from each sample was reverse transcribed using the high-capacity cDNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The mRNA expression levels of targeted genes (CTNNB1, WNT5A, SUFU) were determined using a CFX-96 real-time qPCR detection system (Bio-Rad Laboratories, Inc.). All qPCR reactions were performed in triplicate using TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus PCR master mix; Takara Biotechnology Co., Ltd.). The following thermocycling conditions were used: Initial denaturation at 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 30 sec. The CFX96 manager software version 3.1 (Bio-Rad Laboratories, Inc.) was used to generate the cycle threshold values, and the data were analyzed using the 2−ΔΔCq method (51). The relative mRNA expression levels of CTNNB1, WNT5A, and SUFU were normalized against the mRNA expression levels of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as an endogenous control. The specificity of qPCR amplification was confirmed using melting curve analysis. The primer sequences used for mRNA analysis are presented in Table I.

For microRNA analysis, total RNA was isolated from five consecutive 5-µm thick sections of FFPE control placental tissue (n=14) and IUGR placental tissue (n=14) as described above and purified with the ‘NucleoSpin miRNA Plasma̛ kit (Macherey-Nagel, Germany). Reverse transcription was performed using the ‘TaqMan MicroRNA Reverse Transcription Kit’ (Applied Biosystems) and specific loop primers for Hsa-miR-214-3p (assay ID 002306, Applied Biosystems, USA) and Has-miR-378a-5p (assay ID 000567, Applied Biosystems, USA) following the manufacturer's procedure. The expression levels of targeted miRNAs were determined using the ‘TaqMan microRNA Assay’ and ‘TaqMan™ Universal Master Mix II, no UNG’ (Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. Small nuclear RNA U6 (U6 snRNA assay ID 001973, Applied Biosystems, USA) was used as an endogenous control. The following thermocycling conditions (CFX-96 real-time qPCR detection system; Bio-Rad Laboratories, Inc.) were used: Initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 60 sec. All qPCR reactions were performed in triplicate, and data were analyzed using the 2−ΔΔCq method as described above (51).

Statistical analysis

The normality of data distribution was tested using the Shapiro-Wilk test. Continuous variables are shown as mean ± standard deviation (SD) or median with interquartile range (Q1, Q3). Categorical variables were presented as frequencies (n) and percentages (%). Based on the normality of data distribution, the group differences for quantitative variables were analyzed using the unpaired Student's t-test (normally distributed data) or the Mann-Whitney U test (non-normally distributed data), correspondingly. Categorical variables were compared using the Chi-square or Fisher's exact test, as appropriate. After Chi-square or Fisher's exact test, and to correct for multiple comparisons, where necessary, Bonferroni correction was used and corrective t-values stated, as appropriate. The two-tailed P < 0.05 was considered statistically significant. All analyses were performed using the SPSS Statistics software version 27.0 (IBM Corp.).

Results

Clinical data - physiological and IUGR pregnancies

The following clinical variables were analyzed: maternal age, maternal body weight and height, maternal weight gain and body mass index (BMI) before pregnancy and at time of delivery, fetal body weight and height, placental weight and fetal/ placental weight ratio. Moreover, the gender of the newborns and mode of delivery was also analyzed. As expected, a statistically smaller fetal weight, height and placental weight were found in newborns from IUGR pregnancies (P<0.001). IUGR was more frequent in female newborns (P=0.033), and pregnancies complicated with IUGR were significantly more often completed with cesarean section delivery than physiological pregnancies (P=0.001), which was also expected. The mean maternal age in the IUGR group was 31.6 and was significantly higher compared with healthy controls with a mean age of 28.5 years (P=0.035). Median gestational age at delivery was significantly lower in the IUGR group compared with the control group, 38+3/7 (38+2/7, 39+4/7) and 39+3/7 weeks (39+3/7, 40+5/7), respectively (P=0.001) (Table II).

Table II.

Clinical parameters of mothers and newborns from IUGR and physiological pregnancies.

Table II.

Clinical parameters of mothers and newborns from IUGR and physiological pregnancies.

VariableControl (n=18)IUGR (n=34)P-value
Maternal age, years28.5±3.631.6±5.50.035a
Gestational age at delivery, weeks+days39+3/7 (39+2/7, 40+5/7)38+3/7 (38+2/7, 39+4/7)0.001a
Pre-pregnancy BMI, kg/m221.9 (19.3, 22.9)20.2 (19.0, 21.7)0.532
BMI at delivery, kg/m226.6±2.726.0±3.00.532
Maternal body height, cm168.4±5.5166.2±7.00.253
Maternal body weight at delivery, kg75.4±8.072.0±9.60.210
Total weight gain during pregnancy, kg16.0 (13.0, 18.5)14.0 (11.0, 20.0)0.159
Fetal birth weight, g3,516.7±336.92435.9±195.9 <0.001a
Fetal height, cm51.0 (50.0, 51.2)46.0 (45.7, 48.0) <0.001a
Placental weight, g554.6±76.6369.7±80.2 <0.001a
Fetal/placental weight ratio6.4±0.96.9±1.50.253
Sex, n (%)
  Male13 (72.2)14 (41.2)0.033a
  Female5 (27.8)20 (58.8)
Mode of delivery, n (%)
  Cesarean section0 (0.0)14 (41.2)0.001a
  Vaginal delivery18 (100.0)20 (58.8)

a Statistically significant difference. Values are presented as the mean ± standard deviation, median (Q1, Q3) or n (%). IUGR, intrauterine growth restriction.

Expression levels of WNT5A, SUFU, and CTNNB1 mRNA

The RT-qPCR analysis showed that all targeted genes (WNT5A, SUFU, and CTNNB1) were transcriptionally active in both IUGR and control placenta tissue samples. The relative mRNA expression levels of WNT5A, SUFU, and CTNNB1 genes were higher in the IUGR than in the control tissue (Fig. 1). However, none of the observed differences in mRNA expression levels was statistically significant. Regarding the mRNA expression levels of targeted genes in IUGR tissue samples analyzed as a separate group, the CTNNB1 gene showed the highest transcriptional activity, followed by the SUFU and WNT5A genes. In control tissue samples, the CTNNB1 gene also showed the highest expression levels among the targeted genes analyzed. In contrast, the expression levels of the SUFU gene were lower than those observed for the WNT5A gene (data not shown). No statistically significant gene expression was detected in the last analysis as well.

WNT5A, β-catenin, and SUFU protein expression in IUGR placentas

In IUGR placentas, WNT5A and β-catenin were expressed in >10% of endothelial cells in 70.5 and 79.4% samples, respectively. In contrast, these proteins were expressed in <10% of endothelial cells in physiological placentas in 94.4 and 55.6% of samples. In IUGR placentas, β-catenin was expressed in >10% of trophoblast cells in 94.1% of the samples, compared with 66.7% of the samples from placentas with uncomplicated pregnancies. On the other hand, in both placental groups, WNT5A and β-catenin expression in >10% of stromal cells were observed in 100% of the samples (Table III).

Table III.

WNT5A, β-catenin and SUFU protein expression in IUGR and normal (control) placentas.

Table III.

WNT5A, β-catenin and SUFU protein expression in IUGR and normal (control) placentas.

ThrophoblastsStromal cellsEndothelial cells



ProteinNormal placentas, n (%) (n=18)IUGR placentas, n (%) (n=34)P-valueNormal placentas, n (%) (n=18)IUGR placentas, n (%) (n=34)P-valueNormal placentas, n (%) (n=18)IUGR placentas, n (%) (n=34)P-value
WNT5A, % 0.718 0.873 <0.001a
  >5016 (88.9)29 (85.3) 11 (61.1)20 (58.8) 0 (0.0)6 (17.6)
  10-502 (11.1)5 (14.7) 7 (38.9)14 (41.2) 1 (5.6)18 (52.9)
  <100 (0.0)0 (0.0) 0 (0.0)0 (0.0) 9 (50.0)3 (8.8)
  00 (0.0)0 (0.0) 0 (0.0)0 (0.0) 8 (44.4)7 (20.7)
β-catenin, % 0.059 0.602 0.002a
  >503 (16.7)11 (32.4) 16 (88.8)32 (94.1) 0 (0.0)16 (47.1)
  10-509 (50.0)21 (61.7) 2 (11.2)2 (5.9) 8 (44.4)11 (32.3)
  <105 (27.8)2 (5.9) 0 (0.0)0 (0.0) 2 (11.2)3 (8.8)
  01 (5.5)0 (0.0) 0 (0.0)0 (0.0) 8 (44.4)4 (11.8)
SUFU, % 0.030b 0.105 0.440
  >505 (27.8)17 (50.0) 8 (44.4)20 (58.8) 0 (0.0)2 (5.9)
  10-509 (50.0)17 (50.0) 7 (38.9)14 (41.2) 10 (55.5)18 (52.9)
  <102 (11.1)0 (0.0) 2 (11.2)0 (0.0) 5 (27.8)12 (35.3)
  02 (11.1)0 (0.0) 1 (5.5)0 (0.0) 3 (16.7)2 (5.9)

a Statistically significant with Bonferroni correction of 0.006.

b Statistically not significant with Bonferroni correction of 0.006. IUGR, intrauterine growth restriction; SUFU, suppressor of fused.

The expression of WNT5A, the positive regulator of the Wnt signaling pathway, was significantly higher in endothelial cells of placental villi (P<0.001) in placentas with IUGR compared with term placentas from physiologic pregnancies. β-catenin also exhibited a significantly higher expression in trophoblasts (P=0.026) and endothelial cells of placental villi (P<0.001) in IUGR placentas compared with the physiologic placentas (Figs. 2 and 3).

SUFU protein expression was observed in >10% of trophoblast cells in 100% samples of IUGR placentas and 77.6% samples of physiological placentas. The protein expression in >10% of stromal cells of IUGR placentas was observed in 100% of samples in the IUGR group and 83.3% in the control group. SUFU protein expression was significantly higher in trophoblasts in IUGR placentas (P=0.029) than in physiologic ones (Table III; Figs. 2 and 3).

Expression levels of miR-214-3p and miR-378a-5p

The RT-qPCR analysis results showed that targeted miRNAs (miR-214-3p and miR-378a-5p) were expressed in all tissue samples. Furthermore, both miR-214-3p (P=0.040) and miR-378a-5p (P<0.001) showed a significantly lower expression in the IUGR compared to control placental tissue (Fig. 4). Also, in control tissue samples analyzed as a separate group, the miR-378a-5p showed higher transcriptional activity. However, the observed difference was insignificant (data not shown). Contrary to the IUGR tissue group, both targeted miRNAs showed almost the same expression levels that were lower than their expression values in the control tissue group (data not shown).

DNA promoter methylation status of SUFU gene in IUGR placentas

DNA promoter methylation of the SUFU gene was analyzed by the methylation-specific PCR assay in 10 IUGR and 14 physiologic placentas. SUFU gene promoter was unmethylated in all physiologic placentas, while in the IUGR group, one placenta showed weak methylation of the SUFU gene promoter. In other IUGR placentas, the SUFU gene promoter was unmethylated (Fig. 5).

Discussion

Since WNT5A and β-catenin are positive regulators of the Wnt pathway, their significantly lower expression in placentas from IUGR compared to the placentas from physiologic, uncomplicated pregnancies could have been expected. Our results showed significantly higher protein expression of WNT5A and β-catenin in IUGR placentas compared to placentas from uncomplicated pregnancies. These results align with our previous study that revealed significantly higher expression of all three Dishevelled proteins (DVL1-3) in IUGR placentas, indicating their potential effects on placental hypoxia and angiogenesis in IUGR (52).

Uteroplacental insufficiency causes placental hypoperfusion and chronic hypoxia and is one of the leading causes of IUGR. Numerous studies report the association between oxidative stress and IUGR (5355) and the contribution of oxidative stress to the IUGR metabolic sequelae (56). Zhang et al (57) reported that oxidative stress upregulates Wnt signaling in a concentration-dependent manner and induces angiogenic activity, thus contributing to neovascularization. Funato et al (58) also found that reactive oxygen species (ROS) promoted β-catenin stabilization. Vikram et al (59) reported that suppressing oxidative stress by antioxidants prevents β-catenin dephosphorylation in endothelial cells. At the same time, the β-catenin expression also increased ROS in endothelial cells and whole blood vessels, suggesting that ROS could be both upstream mediators and downstream effectors of Wnt signaling (59). Moreover, it has been reported that active WNT3A and β-catenin could upregulate tumor necrosis factor-alpha (TNF-α) in endothelial cells, thus promoting endothelial dysfunction (60). Increased expression of β-catenin also diminished vascular nitrogen oxide (NO) bioavailability and impaired endothelium-dependent vasorelaxation (59). Moreover, endothelial cells from patients suffering from type 2 diabetes mellitus had a 1.3-fold higher WNT5A expression. Furthermore, inhibition of WNT5A restored endothelial NO synthase activity, improved nitric oxide production and abrogated endothelial dysfunction (61).

This data suggests that placental dysfunction was triggered by hypoxia and oxidative stress. This may be partially explained by the higher β-catenin expression in endothelial and trophoblast cells and higher WNT5A expression in endothelial cells in IUGR placentas obtained in our research.

Various studies emphasized the importance of Wnt signaling in regulating apoptosis and suggested its antiapoptotic activity (62,63). That said, Wnt signaling activation, as showed in our IUGR placentas, could be a protective mechanism that, besides inducing angiogenesis and supporting vasorelaxation, could improve uteroplacental blood flow and fetal oxygenation and be protective by reducing apoptotic activity and negative consequences of oxidative stress.

On the other hand, other studies are not in accordance with our results. Fan et al (64) reported active, dephosphorylated β-catenin and Matrix Metallopeptidase 9 (MMP-9) levels to be significantly lower in preeclampsia, especially a severe form, compared with placentas from normal pregnancies, thus suggesting the shallow invasion that is associated with preeclampsia (65) to be regulated by β-catenin via Snail and MMP-9 (64). Other studies also confirmed lower β-catenin expression in trophoblast cells affected by hypoxia and inhibited proliferation, weakened migration, invasion, and excessive apoptosis (66). Trophoblast invasion is vital for normal embryonic development. The extravillous trophoblast is formed in epithelium-mesenchymal transition (EMT) (67). Its capacity to invade the spiral arteries, mediate the destruction of the arterial wall and replace the endothelium is essential for pregnancy progress (68). There is evidence that Hh signaling plays an essential role in EMT and invasion. Tang et al (69) found higher expression of Hh ligands in the villous core as Wnt-producing tissues and higher expression of Hh receptors PTCH1 and SMO in trophoblast layers as Wnt-responding tissues. They also found that the Hh ligand stimulates the EMT of human cytotrophoblast cells.

In contrast, knockdown of Gli1 and Gli2 attenuated SHH-induced EMT (indicated by lower vimentin and higher E-cadherin expressions) and colony formation (69). Zhang and Zhang found that Forkhead Box C2 (FOXC2) facilitates trophoblast invasion through the activation of the Hh pathway-trophoblast cells with overexpression of FOXC2 also experienced higher expression levels of SHH, Gli and Snail and were more invasive (70). The effect was reverted when the samples were treated with siRNA targeting FOXC2 (70). All these data emphasize the importance of Hh signaling in human trophoblast physiology. To the best of our knowledge, the role of SUFU in placentation and IUGR has not been addressed by any previous study. Our results showed that its expression is significantly higher in the trophoblast cells of the IUGR placentas, whereas there were no differences in endothelium and stromal cells. As a negative regulator of the Hh pathway, higher expression of SUFU in IUGR trophoblast cells may contribute to lower activity of Hh signaling and subsequently to impaired trophoblast function in IUGR placentas.

Since SUFU is a negative regulator of the Hh pathway and possibly the Wnt pathway, its greater protein expression in IUGR placentas could be expected. Our results align with that, but higher protein expression of positive Wnt pathway regulators, WNT5A and β-catenin, was also found in IUGR placentas than normal ones. Higher expression of SUFU protein in that context could reveal another role of SUFU. Liu et al (71) demonstrated that SUFU could also be a positive regulator of the Hh pathway, thus maximizing Hh pathway activation. Moreover, it has been reported that RIO kinase 3 (RIOK3) acts as a SUFU-dependent positive regulator of Hh signaling (72), suggesting that SUFU could exert its double function as a positive regulator through other compounds.

In contrast to their protein expressions, the RT-qPCR analysis revealed no significant difference in WNT5A, SUFU, and CTNNB1 mRNA expressions between IUGR placentas and controls. This could be explained by the fact that IHC analysis enabled protein expression analysis and quantification in different placental compartments (trophoblasts, stromal cells and endothelial cells). In contrast, RT-qPCR analysis was performed in whole placental tissue sections.

In our study, other than the SUFU gene and protein expression, we also wanted to perceive the SUFU gene promoter methylation status. Our results show that the SUFU gene promoter is unmethylated in all but one IUGR placenta. It is also unmethylated in all the placentas from uncomplicated pregnancies. We conclude that other epigenetic mechanisms might regulate SUFU gene expression based on these results. Although it has been demonstrated that DNA methylation is an essential epigenetic mechanism in the human placenta and that IUGR is significantly associated with altered DNA methylation patterns in the placenta (30,73), growing evidence, including our results, suggests other epigenetic mechanisms could also be fundamental in placental gene expression regulation. Kimura et al (74) demonstrated that histone post-translational modifications could be an essential mechanism of placental gene expression regulation. Moreover, Chuang et al (75) reported that histone modification is linked with the expression of genes that are decisive for mediating trophoblastic fusion and, therefore, proper placental structure and function.

MiRNAs appear to be actively involved in placental gene regulation and development (76). It has been reported that the expression of several placenta-specific miRNAs has been reduced in placentas from pregnancies with IUGR than in placentas from uncomplicated pregnancies (77). Pineles et al (78) reported specific miRNA expression patterns associated with preeclampsia, which was also confirmed by Zhu et al (79). Another study also confirmed functional miRNAs in the trophoblast. The specific miRNAs in the placenta can be up or down-regulated by the varying oxygen levels, primarily in a hypoxic environment (80). This is an interesting finding that could be important in IUGR since IUGR is associated with chronic hypoxia, as we already stressed earlier. Peng et al (81) reported that SUFU was regulated by miRNA-20b and induced cell proliferation, migration and EMT by negatively regulating both Wnt and Hh signalling pathways.

Several studies reported SUFU gene expression to be epigenetically downregulated by miRNAs and thus silenced in various tumors such as breast, gastric, basal cell, or non-small cell lung carcinomas (8285). Alimirah et al (82) reported that miR-214 targets the SUFU gene, which then inhibits its expression in breast cancer. This finding was also confirmed in another study that found SUFU gene expression negatively correlated with miR-214 expression, indicating that miR-214 directly targeted SUFU expression and Hh signaling in promoting liver fibrosis (86). Moreover, He et al (44) reported precisely the miR-214-3p-SUFU-GLI1 axis as the critical signaling pathway responsible for smooth muscle cell (SMC) differentiation and generation from adventitial stem/progenitor cells (AdSPCs) important for controlling neointimal hyperplasia. MiR-214-3p controls vascular SMC proliferation and migration, while SUFU is identified as its true target gene that operates as a transcriptional repressor of SMC contractile genes, which is essential in the context of vascular remodeling after injury (44).

MiR-378a-5p was reported to negatively regulate the expression of SUFU as a target gene in melanomas. That is important since miR-378a-5p was found to increase cell migration and invasion and to have proangiogenic activity by significantly inducing angiogenic growth factor VEGF secretion, which then increases in vivo and in vitro angiogenesis (87). Earlier studies also reported miR-378a-5p as a promoter of angiogenesis by upregulating VEGF, thus inducing neovascularization in hypoxia by targeting the SUFU gene (45,88).

Based on these studies on other tissues showing miR-214-3p and miR-378a-5p to modulate SUFU expression, we wanted to identify their potential involvement in the regulation of SUFU expression in placentas and, especially, in IUGR placentas. This is particularly interesting due to the role of these miRNAs in vascular remodeling and angiogenesis. Our results showed that miR-214-3p and miR-378a-5p expressions were increased in control placentas compared with IUGR placentas. This aligns with protein expression results where SUFU protein expression was increased in IUGR term placentas compared with physiological ones. Our results also suggest that miR-214-3p and miR-378a-5p targeting could be involved in epigenetic regulation of SUFU gene expression in normal and IUGR placental tissue.

We found mean maternal age to be significantly higher in the IUGR group compared with the control group. This is interesting since there are conflicting reports regarding the association between maternal age and risk for IUGR. Some studies found increased maternal age to be an independent risk factor for IUGR, which is in line with our findings (89,90). Other studies did not find any association between maternal age and IUGR risk (9193), while Yu et al (94) reported younger maternal age as a risk factor for IUGR.

There are several limitations of the present study. First, the sample size was moderate. Second, the study did not explore the functional impact of the targeted mRNA and miRNA expression on trophoblast cells. It would also be interesting to focus on other epigenetic mechanisms besides the reported miR-214-3p, miR378a-5p and DNA methylation in placentas with IUGR. Our future studies will focus on the shortcomings of the current study.

Our study provides new insights on the involvement of the Wnt and Hh signaling pathways and epigenetic regulation of SUFU gene expression in the placenta and IUGR. However, our results should be further explored in a larger cohort to specify more closely their exact functional roles in placental insufficiency, detection or surveillance of IUGR, and optimal delivery planning. The precise functional impact of miR-214-3p and miR-378a-5p on SUFU gene expression in these tissue and pathological settings should be scrutinized as well.

Acknowledgements

Not applicable.

Funding

This research was co-financed by the European Union through the Europe Regional Development Fund, Operational Programme Competitiveness and Cohesion, under grant agreement no. KK.01.1.1.01.0008, Reproductive and Regenerative Medicine-Exploring New Platforms and Potentials.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

IMS contributed to conceptualization, data interpretation, data acquisition and analysis, performed experimental work, wrote and edited the manuscript, and revised the manuscript for important intellectual content. VKK contributed to conceptualization, interpretation and design of experiments, edited the manuscript, and revised the manuscript for important intellectual content. FP contributed to data analysis and interpretation, performed experimental work, and revised the manuscript for important intellectual content. LL contributed to data analysis and interpretation, and revised the manuscript for important intellectual content. MG contributed to data interpretation, performed experimental work and revised the manuscript for important intellectual content. NS contributed to data interpretation, and revised the manuscript for important intellectual content. TD contributed to data interpretation and performed experimental work. AS contributed to data analysis and interpretation, and revised the manuscript for important intellectual content. KK contributed to data interpretation, and revised the manuscript for important intellectual content. SV contributed to data analysis and interpretation, and revised the manuscript for important intellectual content. LS conceived the idea, contributed to conceptualization, data collection and analysis and interpretation of the results, and revised the manuscript for important intellectual content. LS and IMS confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of the School of Medicine, University of Zagreb, Zagreb, Croatia (641-01/22-02/01; 30th October 2018) and the Ethics Committee of the University Hospital Merkur Zagreb, Zagreb, Croatia (03/1-1341; 14th February 2018). Written informed consent was obtained from all participants involved in the study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

ACOG Practice bulletin no. 134, . Fetal growth restriction. Obstet Gynecol. 121:1122–1133. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Hutter D, Kingdom J and Jaeggi E: Causes and mechanisms of intrauterine hypoxia and its impact on the fetal cardiovascular system: A review. Int J Pediatr. 2010:4013232010. View Article : Google Scholar : PubMed/NCBI

3 

Krishna U and Bhalerao S: Placental insufficiency and fetal growth restriction. J Obstet Gynaecol India. 61:505–511. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Pollack RN and Divon MY: Intrauterine growth retardation: Definition, classification, and etiology. Clin Obstet Gynecol. 35:99–107. 1992. View Article : Google Scholar : PubMed/NCBI

5 

Guellec I, Lapillonne A, Renolleau S, Charlaluk ML, Roze JC, Marret S, Vieux R, Monique K and Ancel PY; EPIPAGE Study Group, : Neurologic outcomes at school age in very preterm infants born with severe or mild growth restriction. Pediatrics. 127:e883–e891. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Sacchi C, Marino C, Nosarti C, Vieno A, Visentin S and Simonelli A: Association of intrauterine growth restriction and small for gestational age status with childhood cognitive outcomes: A systematic review and meta-analysis. JAMA Pediatr. 174:772–781. 2020. View Article : Google Scholar : PubMed/NCBI

7 

Levine TA, Grunau RE, McAuliffe FM, Pinnamaneni R, Foran A and Alderdice FA: Early childhood neurodevelopment after intrauterine growth restriction: A systematic review. Pediatrics. 135:126–141. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Latos PA and Hemberger M: From the stem of the placental tree: Trophoblast stem cells and their progeny. Development. 143:3650–3660. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Hemberger M, Hanna CW and Dean W: Mechanisms of early placental development in mouse and humans. Nat Rev Genet. 21:27–43. 2020. View Article : Google Scholar : PubMed/NCBI

10 

Knöfler M and Pollheimer J: Human placental trophoblast invasion and differentiation: A particular focus on Wnt signaling. Front Genet. 4:1902013. View Article : Google Scholar : PubMed/NCBI

11 

Matsuura K, Jigami T, Taniue K, Morishita Y, Adachi S, Senda T, Nonaka A, Aburatani H, Nakamura T and Akiyama T: Identification of a link between Wnt/β-catenin signalling and the cell fusion pathway. Nat Commun. 2:5482011. View Article : Google Scholar : PubMed/NCBI

12 

Aoki M, Mieda M, Ikeda T, Hamada Y, Nakamura H and Okamoto H: R-spondin3 is required for mouse placental development. Dev Biol. 301:218–226. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Miller JR: The Wnts. Genome Biol. 3:Reviews30012002.PubMed/NCBI

14 

Logan CY and Nusse R: The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 20:781–810. 2004. View Article : Google Scholar : PubMed/NCBI

15 

Cadigan KM and Peifer M: Wnt signaling from development to disease: Insights from model systems. Cold Spring Harb Perspect Biol. 1:a0028812009. View Article : Google Scholar : PubMed/NCBI

16 

van Amerongen R and Nusse R: Towards an integrated view of Wnt signaling in development. Development. 136:3205–3214. 2009. View Article : Google Scholar : PubMed/NCBI

17 

MacDonald BT, Tamai K and He X: Wnt/beta-catenin signaling: Components, mechanisms, and diseases. Dev Cell. 17:9–26. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Kaufmann P, Black S and Huppertz B: Endovascular trophoblast invasion: Implications for the pathogenesis of intrauterine growth retardation and preeclampsia. Biol Reprod. 69:1–7. 2003. View Article : Google Scholar : PubMed/NCBI

19 

Sonderegger S, Pollheimer J and Knöfler M: Wnt signalling in implantation, decidualisation and placental differentiation-review. Placenta. 31:839–847. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Ma XR, Edmund Sim UH, Pauline B, Patricia L and Rahman J: Overexpression of WNT2 and TSG101 genes in colorectal carcinoma. Trop Biomed. 25:46–57. 2008.PubMed/NCBI

21 

Geng M, Cao YC, Chen YJ, Jiang H, Bi LQ and Liu XH: Loss of Wnt5a and Ror2 protein in hepatocellular carcinoma associated with poor prognosis. World J Gastroenterol. 18:1328–1338. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Bui TD, Zhang L, Rees MC, Bicknell R and Harris AL: Expression and hormone regulation of Wnt2, 3, 4, 5a, 7a, 7b and 10b in normal human endometrium and endometrial carcinoma. Br J Cancer. 75:1131–1136. 1997. View Article : Google Scholar : PubMed/NCBI

23 

Ge JF, Xu YY, Qin G, Cheng JQ and Chen FH: Resveratrol Ameliorates the anxiety- and depression-like behavior of subclinical hypothyroidism rat: Possible involvement of the HPT Axis, HPA Axis, and Wnt/β-Catenin Pathway. Front Endocrinol (Lausanne). 7:442016. View Article : Google Scholar : PubMed/NCBI

24 

Oishi I, Suzuki H, Onishi N, Takada R, Kani S, Ohkawara B, Koshida I, Suzuki K, Yamada G, Schwabe GC, et al: The receptor tyrosine kinase Ror2 is involved in non-canonical Wnt5a/JNK signalling pathway. Genes Cells. 8:645–654. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Tang Y, Gholamin S, Schubert S, Willardson MI, Lee A, Bandopadhayay P, Bergthold G, Masoud S, Nguyen B, Vue N, et al: Epigenetic targeting of Hedgehog pathway transcriptional output through BET bromodomain inhibition. Nat Med. 20:732–740. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Rubin LL and de Sauvage FJ: Targeting the Hedgehog pathway in cancer. Nat Rev Drug Discov. 5:1026–1033. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Jia Y, Wang Y and Xie J: The Hedgehog pathway: Role in cell differentiation, polarity and proliferation. Arch Toxicol. 89:179–191. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Jeng KS, Chang CF and Lin SS: Sonic Hedgehog signaling in organogenesis, tumors, and tumor microenvironments. Int J Mol Sci. 21:7582020. View Article : Google Scholar : PubMed/NCBI

29 

Min TH, Kriebel M, Hou S and Pera EM: The dual regulator Sufu integrates Hedgehog and Wnt signals in the early Xenopus embryo. Dev Biol. 358:262–276. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Koukoura O, Sifakis S and Spandidos DA: DNA methylation in the human placenta and fetal growth (review). Mol Med Rep. 5:883–889. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Serman L, Vlahović M, Sijan M, Bulić-Jakus F, Serman A, Sincić N, Matijević R, Jurić-Lekić G and Katusić A: The impact of 5-azacytidine on placental weight, glycoprotein pattern and proliferating cell nuclear antigen expression in rat placenta. Placenta. 28:803–811. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Chelbi ST, Mondon F, Jammes H, Buffat C, Mignot TM, Tost J, Busato F, Gut I, Rebourcet R, Laissue P, et al: Expressional and epigenetic alterations of placental serine protease inhibitors: SERPINA3 is a potential marker of preeclampsia. Hypertension. 49:76–83. 2007. View Article : Google Scholar : PubMed/NCBI

33 

Ferreira JC, Choufani S, Grafodatskaya D, Butcher DT, Zhao C, Chitayat D, Shuman C, Kingdom J, Keating S and Weksberg R: WNT2 promoter methylation in human placenta is associated with low birthweight percentile in the neonate. Epigenetics. 6:440–449. 2011. View Article : Google Scholar : PubMed/NCBI

34 

Dexheimer PJ and Cochella L: MicroRNAs: From mechanism to organism. Front Cell Dev Biol. 8:4092020. View Article : Google Scholar : PubMed/NCBI

35 

Duchaine TF and Fabian MR: Mechanistic insights into MicroRNA-Mediated gene silencing. Cold Spring Harb Perspect Biol. 11:a0327712019. View Article : Google Scholar : PubMed/NCBI

36 

Gebert LFR and MacRae IJ: Regulation of microRNA function in animals. Nat Rev Mol Cell Biol. 20:21–37. 2019. View Article : Google Scholar : PubMed/NCBI

37 

Paul P, Chakraborty A, Sarkar D, Langthasa M, Rahman M, Bari M, Singha RS, Malakar AK and Chakraborty S: Interplay between miRNAs and human diseases. J Cell Physiol. 233:2007–2018. 2018. View Article : Google Scholar : PubMed/NCBI

38 

Ciesla M, Skrzypek K, Kozakowska M, Loboda A, Jozkowicz A and Dulak J: MicroRNAs as biomarkers of disease onset. Anal Bioanal Chem. 401:2051–2061. 2011. View Article : Google Scholar : PubMed/NCBI

39 

Huang W: MicroRNAs: Biomarkers, diagnostics, and therapeutics. Methods Mol Biol. 1617:57–67. 2017. View Article : Google Scholar : PubMed/NCBI

40 

Kochhar P, Dwarkanath P, Ravikumar G, Thomas A, Crasta J, Thomas T, Kurpad AV and Mukhopadhyay A: Placental expression of miR-21-5p, miR-210-3p and miR-141-3p: Relation to human fetoplacental growth. Eur J Clin Nutr. 76:730–738. 2022. View Article : Google Scholar : PubMed/NCBI

41 

Zarkovic M, Hufsky F, Markert UR and Marz M: The Role of Non-Coding RNAs in the Human Placenta. Cells. 11:15882022. View Article : Google Scholar : PubMed/NCBI

42 

Xu P, Ma Y, Wu H and Wang YL: Placenta-Derived MicroRNAs in the pathophysiology of Human pregnancy. Front Cell Dev Biol. 9:6463262021. View Article : Google Scholar : PubMed/NCBI

43 

Awamleh Z, Gloor GB and Han VKM: Placental microRNAs in pregnancies with early onset intrauterine growth restriction and preeclampsia: Potential impact on gene expression and pathophysiology. BMC Med Genomics. 12:912019. View Article : Google Scholar : PubMed/NCBI

44 

He S, Yang F, Yang M, An W, Maguire EM, Chen Q, Xiao R, Wu W, Zhang L, Wang W and Xiao Q: miR-214-3p-Sufu-GLI1 is a novel regulatory axis controlling inflammatory smooth muscle cell differentiation from stem cells and neointimal hyperplasia. Stem Cell Res Ther. 11:4652020. View Article : Google Scholar : PubMed/NCBI

45 

Lee DY, Deng Z, Wang CH and Yang BB: MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression. Proc Natl Acad Sci USA. 104:20350–20355. 2007. View Article : Google Scholar : PubMed/NCBI

46 

Hyun J, Wang S, Kim J, Rao KM, Park SY, Chung I, Ha CS, Kim SW, Yun YH and Jung Y: MicroRNA-378 limits activation of hepatic stellate cells and liver fibrosis by suppressing Gli3 expression. Nat Commun. 7:109932016. View Article : Google Scholar : PubMed/NCBI

47 

Kardum V, Karin V, Glibo M, Skrtic A, Martic TN, Ibisevic N, Skenderi F, Vranic S and Serman L: Methylation-associated silencing of SFRP1 gene in high-grade serous ovarian carcinomas. Ann Diagn Pathol. 31:45–49. 2017. View Article : Google Scholar : PubMed/NCBI

48 

Rizzardi AE, Johnson AT, Vogel RI, Pambuccian SE, Henriksen J, Skubitz AP, Metzger GJ and Schmechel SC: Quantitative comparison of immunohistochemical staining measured by digital image analysis versus pathologist visual scoring. Diagn Pathol. 7:422012. View Article : Google Scholar : PubMed/NCBI

49 

Vrsalovic MM, Korac P, Dominis M, Ostojic S, Mannhalter C and Kusec R: T- and B-cell clonality and frequency of human herpes viruses-6, −8 and Epstein Barr virus in angioimmunoblastic T-cell lymphoma. Hematol Oncol. 22:169–177. 2004. View Article : Google Scholar : PubMed/NCBI

50 

Paluszczak J, Wiśniewska D, Kostrzewska-Poczekaj M, Kiwerska K, Grénman R, Mielcarek-Kuchta D and Jarmuż-Szymczak M: Prognostic significance of the methylation of Wnt pathway antagonists-CXXC4, DACT2, and the inhibitors of sonic hedgehog signaling-ZIC1, ZIC4, and HHIP in head and neck squamous cell carcinomas. Clin Oral Investig. 21:1777–1788. 2017. View Article : Google Scholar : PubMed/NCBI

51 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

52 

Sola IM, Serman A, Karin-Kujundzic V, Paic F, Skrtic A, Slatina P, Kakarigi L, Vranic S and Serman L: Dishevelled family proteins (DVL1-3) expression in intrauterine growth restriction (IUGR) placentas. Bosn J Basic Med Sci. 21:447–453. 2021.PubMed/NCBI

53 

Julian CG, Wilson MJ, Lopez M, Yamashiro H, Tellez W, Rodriguez A, Bigham AW, Shriver MD, Rodriguez C, Vargas E and Moore LG: Augmented uterine artery blood flow and oxygen delivery protect Andeans from altitude-associated reductions in fetal growth. Am J Physiol Regul Integr Comp Physiol. 296:R1564–R1575. 2009. View Article : Google Scholar : PubMed/NCBI

54 

Williams LA, Evans SF and Newnham JP: Prospective cohort study of factors influencing the relative weights of the placenta and the newborn infant. BMJ. 314:1864–1868. 1997. View Article : Google Scholar : PubMed/NCBI

55 

Thompson LP: Effects of chronic hypoxia on fetal coronary responses. High Alt Med Biol. 4:215–224. 2003. View Article : Google Scholar : PubMed/NCBI

56 

Rashid CS, Bansal A and Simmons RA: Oxidative stress, intrauterine growth restriction, and developmental programming of type 2 diabetes. Physiology (Bethesda). 33:348–359. 2018.PubMed/NCBI

57 

Zhang C, Tannous E and Zheng JJ: Oxidative stress upregulates Wnt signaling in human retinal microvascular endothelial cells through activation of disheveled. J Cell Biochem. 120:14044–14054. 2019. View Article : Google Scholar : PubMed/NCBI

58 

Funato Y, Michiue T, Asashima M and Miki H: The thioredoxin-related redox-regulating protein nucleoredoxin inhibits Wnt-beta-catenin signalling through dishevelled. Nat Cell Biol. 8:501–508. 2006. View Article : Google Scholar : PubMed/NCBI

59 

Vikram A, Kim YR, Kumar S, Naqvi A, Hoffman TA, Kumar A, Miller FJ Jr, Kim CS and Irani K: Canonical Wnt signaling induces vascular endothelial dysfunction via p66Shc-regulated reactive oxygen species. Arterioscler Thromb Vasc Biol. 34:2301–2309. 2014. View Article : Google Scholar : PubMed/NCBI

60 

Spillmann F, Van Linthout S, Miteva K, Lorenz M, Stangl V, Schultheiss HP and Tschöpe C: LXR agonism improves TNF-α-induced endothelial dysfunction in the absence of its cholesterol-modulating effects. Atherosclerosis. 232:1–9. 2014. View Article : Google Scholar : PubMed/NCBI

61 

Bretón-Romero R, Feng B, Holbrook M, Farb MG, Fetterman JL, Linder EA, Berk BD, Masaki N, Weisbrod RM, Inagaki E, et al: Endothelial dysfunction in human diabetes is mediated by Wnt5a-JNK signaling. Arterioscler Thromb Vasc Biol. 36:561–569. 2016. View Article : Google Scholar : PubMed/NCBI

62 

Caricasole A, Copani A, Caraci F, Aronica E, Rozemuller AJ, Caruso A, Storto M, Gaviraghi G, Terstappen GC and Nicoletti F: Induction of Dickkopf-1, a negative modulator of the Wnt pathway, is associated with neuronal degeneration in Alzheimer's brain. J Neurosci. 24:6021–6027. 2004. View Article : Google Scholar : PubMed/NCBI

63 

Alvarez AR, Godoy JA, Mullendorff K, Olivares GH, Bronfman M and Inestrosa NC: Wnt-3a overcomes beta-amyloid toxicity in rat hippocampal neurons. Exp Cell Res. 297:186–196. 2004. View Article : Google Scholar : PubMed/NCBI

64 

Fan M, Xu Y, Hong F, Gao X, Xin G, Hong H, Dong L and Zhao X: Rac1/β-Catenin signalling pathway contributes to trophoblast cell invasion by targeting Snail and MMP9. Cell Physiol Biochem. 38:1319–1332. 2016. View Article : Google Scholar : PubMed/NCBI

65 

Pennington KA, Schlitt JM, Jackson DL, Schulz LC and Schust DJ: Preeclampsia: Multiple approaches for a multifactorial disease. Dis Model Mech. 5:9–18. 2012. View Article : Google Scholar : PubMed/NCBI

66 

Wu Q, Wu G and Li JX: Effect of hypoxia on expression of placental trophoblast cells SATB1 and β-catenin and its correlation with the pathogenesis of preeclampsia. Asian Pac J Trop Med. 9:567–571. 2016. View Article : Google Scholar : PubMed/NCBI

67 

Bischof P and Campana A: Molecular mediators of implantation. Baillieres Best Pract Res Clin Obstet Gynaecol. 14:801–814. 2000. View Article : Google Scholar : PubMed/NCBI

68 

Nadeem L, Munir S, Fu G, Dunk C, Baczyk D, Caniggia I, Lye S and Peng C: Nodal signals through activin receptor-like kinase 7 to inhibit trophoblast migration and invasion: Implication in the pathogenesis of preeclampsia. Am J Pathol. 178:1177–1189. 2011. View Article : Google Scholar : PubMed/NCBI

69 

Tang C, Mei L, Pan L, Xiong W, Zhu H, Ruan H, Zou C, Tang L, Iguchi T and Wu X: Hedgehog signaling through GLI1 and GLI2 is required for epithelial-mesenchymal transition in human trophoblasts. Biochim Biophys Acta. 1850:1438–1448. 2015. View Article : Google Scholar : PubMed/NCBI

70 

Zhang Y and Zhang Y: Forkhead box C2 promotes the invasion ability of human trophoblast cells through Hedgehog (Hh) signaling pathway. Cell Biol Int. 42:859–866. 2018. View Article : Google Scholar : PubMed/NCBI

71 

Liu J, Heydeck W, Zeng H and Liu A: Dual function of suppressor of fused in Hh pathway activation and mouse spinal cord patterning. Dev Biol. 362:141–153. 2012. View Article : Google Scholar : PubMed/NCBI

72 

Tariki M, Wieczorek SA, Schneider P, Bänfer S, Veitinger S, Jacob R, Fendrich V and Lauth M: RIO kinase 3 acts as a SUFU-dependent positive regulator of Hedgehog signaling. Cell Signal. 25:2668–2675. 2013. View Article : Google Scholar : PubMed/NCBI

73 

Banister CE, Koestler DC, Maccani MA, Padbury JF, Houseman EA and Marsit CJ: Infant growth restriction is associated with distinct patterns of DNA methylation in human placentas. Epigenetics. 6:920–927. 2011. View Article : Google Scholar : PubMed/NCBI

74 

Kimura AP, Liebhaber SA and Cooke NE: Epigenetic modifications at the human growth hormone locus predict distinct roles for histone acetylation and methylation in placental gene activation. Mol Endocrinol. 18:1018–1032. 2004. View Article : Google Scholar : PubMed/NCBI

75 

Chuang HC, Chang CW, Chang GD, Yao TP and Chen H: Histone deacetylase 3 binds to and regulates the GCMa transcription factor. Nucleic Acids Res. 34:1459–1469. 2006. View Article : Google Scholar : PubMed/NCBI

76 

Fu G, Brkić J, Hayder H and Peng C: MicroRNAs in Human placental development and pregnancy complications. Int J Mol Sci. 14:5519–5544. 2013. View Article : Google Scholar : PubMed/NCBI

77 

Higashijima A, Miura K, Mishima H, Kinoshita A, Jo O, Abe S, Hasegawa Y, Miura S, Yamasaki K, Yoshida A, et al: Characterization of placenta-specific microRNAs in fetal growth restriction pregnancy. Prenat Diagn. 33:214–222. 2013. View Article : Google Scholar : PubMed/NCBI

78 

Pineles BL, Romero R, Montenegro D, Tarca AL, Han YM, Kim YM, Draghici S, Espinoza J, Kusanovic JP, Mittal P, et al: Distinct subsets of microRNAs are expressed differentially in the human placentas of patients with preeclampsia. Am J Obstet Gynecol. 196:261.e1–e6. 2007. View Article : Google Scholar : PubMed/NCBI

79 

Zhu XM, Han T, Sargent IL, Yin GW and Yao YQ: Differential expression profile of microRNAs in human placentas from preeclamptic pregnancies vs normal pregnancies. Am J Obstet Gynecol. 200:661.e1–e7. 2009. View Article : Google Scholar : PubMed/NCBI

80 

Donker RB, Mouillet JF, Nelson DM and Sadovsky Y: The expression of Argonaute2 and related microRNA biogenesis proteins in normal and hypoxic trophoblasts. Mol Hum Reprod. 13:273–279. 2007. View Article : Google Scholar : PubMed/NCBI

81 

Peng Y, Qin Y, Zhang X, Deng S, Yuan Y, Feng X, Chen W, Hu F, Gao Y, He J, et al: MiRNA-20b/SUFU/Wnt axis accelerates gastric cancer cell proliferation, migration and EMT. Heliyon. 7:e066952021. View Article : Google Scholar : PubMed/NCBI

82 

Alimirah F, Peng X, Gupta A, Yuan L, Welsh J, Cleary M and Mehta RG: Crosstalk between the vitamin D receptor (VDR) and miR-214 in regulating SuFu, a hedgehog pathway inhibitor in breast cancer cells. Exp Cell Res. 349:15–22. 2016. View Article : Google Scholar : PubMed/NCBI

83 

Peng Y, Zhang X, Ma Q, Yan R, Qin Y, Zhao Y, Cheng Y, Yang M, Wang Q, Feng X, et al: MiRNA-194 activates the Wnt/β-catenin signaling pathway in gastric cancer by targeting the negative Wnt regulator, SUFU. Cancer Lett. 385:117–127. 2017. View Article : Google Scholar : PubMed/NCBI

84 

Park M, Kim M, Hwang D, Park M, Kim WK, Kim SK, Shin J, Park ES, Kang CM, Paik YK and Kim H: Characterization of gene expression and activated signaling pathways in solid-pseudopapillary neoplasm of pancreas. Mod Pathol. 27:580–593. 2014. View Article : Google Scholar : PubMed/NCBI

85 

Long H, Wang Z, Chen J, Xiang T, Li Q, Diao X and Zhu B: microRNA-214 promotes epithelial-mesenchymal transition and metastasis in lung adenocarcinoma by targeting the suppressor-of-fused protein (Sufu). Oncotarget. 6:38705–38718. 2015. View Article : Google Scholar : PubMed/NCBI

86 

Ma L, Yang X, Wei R, Ye T, Zhou JK, Wen M, Men R, Li P, Dong B, Liu L, et al: MicroRNA-214 promotes hepatic stellate cell activation and liver fibrosis by suppressing Sufu expression. Cell Death Dis. 9:7182018. View Article : Google Scholar : PubMed/NCBI

87 

Tupone MG, D'Aguanno S, Di Martile M, Valentini E, Desideri M, Trisciuoglio D, Donzelli S, Sacconi A, Buglioni S, Ercolani C, et al: microRNA-378a-5p iS a novel positive regulator of melanoma progression. Oncogenesis. 9:222020. View Article : Google Scholar : PubMed/NCBI

88 

Hua Z, Lv Q, Ye W, Wong CK, Cai G, Gu D, Ji Y, Zhao C, Wang J, Yang BB and Zhang Y: MiRNA-directed regulation of VEGF and other angiogenic factors under hypoxia. PLoS One. 1:e1162006. View Article : Google Scholar : PubMed/NCBI

89 

Odibo AO, Nelson D, Stamilio DM, Sehdev HM and Macones GA: Advanced maternal age is an independent risk factor for intrauterine growth restriction. Am J Perinatol. 23:325–328. 2006. View Article : Google Scholar : PubMed/NCBI

90 

Palatnik A, De Cicco S, Zhang L, Simpson P, Hibbard J and Egede LE: The association between advanced maternal age and diagnosis of small for gestational age. Am J Perinatol. 37:37–43. 2020. View Article : Google Scholar : PubMed/NCBI

91 

Vega J, Sáez G, Smith M, Agurto M and Morris NM: Risk factors for low birth weight and intrauterine growth retardation in Santiago, Chile. Rev Med Chil. 121:1210–1219. 1993.(In Spanish). PubMed/NCBI

92 

Kalinka J, Hanke W and Szymczak W: Risk factors of intrauterine growth retardation: A study of an urban population in Poland. Cent Eur J Public Health. 4:192–196. 1996.PubMed/NCBI

93 

Tierney-Gumaer R and Reifsnider E: Risk factors for low birth weight infants of Hispanic, African American, and White women in Bexar County, Texas. Public Health Nurs. 25:390–400. 2008. View Article : Google Scholar : PubMed/NCBI

94 

Yu SH, Mason J, Crum J, Cappa C and Hotchkiss DR: Differential effects of young maternal age on child growth. Glob Health Action. 9:311712016. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

February-2023
Volume 27 Issue 2

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Sola IM, Karin‑Kujundzic V, Paic F, Lijovic L, Glibo M, Serman N, Duic T, Skrtic A, Kuna K, Vranic S, Vranic S, et al: WNT5A, β‑catenin and SUFU expression patterns, and the significance of microRNA deregulation in placentas with intrauterine growth restriction. Mol Med Rep 27: 28, 2023
APA
Sola, I.M., Karin‑Kujundzic, V., Paic, F., Lijovic, L., Glibo, M., Serman, N. ... Serman, L. (2023). WNT5A, β‑catenin and SUFU expression patterns, and the significance of microRNA deregulation in placentas with intrauterine growth restriction. Molecular Medicine Reports, 27, 28. https://doi.org/10.3892/mmr.2022.12914
MLA
Sola, I. M., Karin‑Kujundzic, V., Paic, F., Lijovic, L., Glibo, M., Serman, N., Duic, T., Skrtic, A., Kuna, K., Vranic, S., Serman, L."WNT5A, β‑catenin and SUFU expression patterns, and the significance of microRNA deregulation in placentas with intrauterine growth restriction". Molecular Medicine Reports 27.2 (2023): 28.
Chicago
Sola, I. M., Karin‑Kujundzic, V., Paic, F., Lijovic, L., Glibo, M., Serman, N., Duic, T., Skrtic, A., Kuna, K., Vranic, S., Serman, L."WNT5A, β‑catenin and SUFU expression patterns, and the significance of microRNA deregulation in placentas with intrauterine growth restriction". Molecular Medicine Reports 27, no. 2 (2023): 28. https://doi.org/10.3892/mmr.2022.12914